Menú

Oídas y venidas

384
Fíjense ustedes si estará en unas condiciones absolutamente deplorables y calamitosas la justicia deportiva en nuestro país que la "Fiscalía Anti Raúl" acaba de admitir a trámite con calzador la denuncia efectuada contra dos capitanes del Real Madrid (Raúl y Guti) por haber dinamitado el fichaje del valencianista David Villa basándose en unas declaraciones de... ¡Ramón Calderón!... Sí señor, Ramón Calderón Ramos, el mismo que viste y calza. Sin ánimo de presumir, debo reconocer sin embargo que servidor, que tampoco es nada dudoso del poco o ningún aprecio profesado hacia la figura del señor Luis Aragonés, lo tuvo bastante más fácil para defender al ex seleccionador nacional de fútbol cuando éste, en uno de sus habituales accesos de ira, llamó, y cito textualmente, "negro de mierda" a Thierry Henry delante de un montón de cámaras de televisión y ante la perplejidad de todo el mundo. Y eso que aquello, si no me falla la memoria, llegó hasta el mismísimo Tony Blair, y siguió coleando justo hasta el día en que Aragonés abandonó el cargo.

Efectivamente, Ramón Calderón dijo que consultaría con los capitanes (citando expresamente a Raúl y a Guti) para conocer la conveniencia y oportunidad de determinados fichajes. Mal hecho por parte de Calderón. Es este, por cierto, exactamente el mismo Calderón que llamó "eterna promesa" a Guti, que dijo que la gente iba al Bernabéu como quien va al teatro, que veinticuatro horas antes de presentar su dimisión dijo que "dimitir era de cobardes" y que no se iría porque él no había cometido ninguna irregularidad, que afirmó sin inmutarse que había visto cuatro o cinco veces a lo largo de dos años y medio al famoso Nanín y que no tenía ninguna relación con él, que sentenció que Luis Bárcena había "realizado un trabajo fantástico para el club", que defendió a los ultrasur y dijo que "no había que estigmatizarlos" o que en plena campaña electoral empeñó su palabra cuando adelantó la noticia de que Kaká, Cesc y Robben jugarían en el Madrid si la candidatura por él encabezada ganaba las elecciones.

¿Acaso todos estos ejemplos que he elegido a vuelapluma y sin tener que bucear demasiado en la hemeroteca confirman que Ramón Calderón no consultara efectivamente a Raúl o Guti acerca del fichaje de Villa?... En absoluto. Esa historia sólo la conocen Calderón, Raúl y Guti, ni siquiera Schuster y mucho menos Villa. Calderón dijo en público que también había que consultar a los capitanes sobre la idoneidad de los fichajes, no sólo del de Villa, pero nadie habrá oído hablar de ese asunto a Raúl o a Guti. Lo que sí confirma lo expuesto anteriormente es que Ramón Calderón, de quien jamás pensé que tendría que volver a hablar en mi vida, es el hombre que tiene la lengua más rápida al sur del río Pecos y que si por algo no se caracterizó precisamente su gestión fue por la fiabilidad. Calderón no es fiable, aunque como fue un presidente kafkiano sí es posible que pidiera opinión a los capitanes. Repito: mal hecho. Pero la carraspera de Schuster, que sabe la historia por oídas y por venidas, en modo alguno confirma que Raúl impidiera el fichaje de Villa. No hay más preguntas, señoría. Caso cerrado antes de ir a juicio. Se levanta la inexistente sesión.
384
comentarios
Escribir comentario
1 wsmith, día

Pooooole!!

2 wsmith, día

Qué afán con arreglar cuentas con Raúl ahora que no juega.

3 wsmith, día

Hala, 1º, 2º y 3º, como Cristiano Ronaldo.

¿Recordáis algún caso en que el mismo árbitro hubiese arbitrado el partido de ida y también el de vuelta?

¿No hay otro que no sea Iturralde?

4 frjparen, día


Copio y pego del anterior hilo sin leer el artículo de hoy, espero Juanma atizes al teutón y me tenga que disculpar, ojalá.

Entremos al tema Rauliano.

Hegemon1 te pido por favor que no leas mi siguiente comentario y a ser posible de no lo comentes, no lo veas como una imposición sino como un ruego, gracias anticipadas.

La credibilidad de Bernd Schuster como mínimo “curiosa”. Bien es cierto que siendo entrenador del Real Madrid tendría información de primerísima mano de lo que se “cocía” en su vestuario, pero hete aquí que me asaltan una serie de dudas.

¿Qué sentido tiene vetar la incorporación de un magnífico delantero? Que ya no jugaría Raúl de titular, bien pero consensuar a todos los capitanes de la plantilla,(Casillas incluido?), no es de recibo.

Aparte la forma de “hacerlo público” con un “toso” la piedra y escondo la mano ha sido vergonzoso por su falta de hombría. Falta de valentía primero por supuestamente dejarse intimidar por Raúl,(algo que no me lo creo), y segundo por esperar que el 7 esté condenado definitivamente al banquillo para dilapidarle, muy bonito Bernie hacer leña del árbol caído, sí señor, ahora te atreves cobardón, eh?

Por último Juanma en estos momentos es cuando hay que dar la cara y batirse el cobre con piezas de caza mayor como el teutón, y no con tus bloggeros incondicionales. Espero que lo remedies, pero has perdido una oportunidad de las buenas de exigir explicaciones y datos concluyentes en antena o en un artículo.

O tal vez creas al alemán-andaluz, y no quieras ahondar en el tema.

Triste muy triste el final que se vislumbra de uno de los mejores jugadores españoles de todos los tiempos, qué asco.

5 frjparen, día


Ya veo y leo que no me tengo que disculpar, a Bernie caricita y Pim pam pum para Calderón, (que me parece estupendo).

Post datas atrasados:

PD: ostane bárbaro en antena, eres un crack.

PDII: Tudemial me gustó mucho tu soneto, enhorabuena.

6 josecho6, día

Los jugadores de fútbol son solo eso, y aquellos de los que estamos hablando reciben un buen pago por jugar y porque se hable de ellos. Si los políticos han de aguantar carros y carretas, los jugadores de fútbol de élite me parece a mí que pueden aguantar tanto o más.
Que el final de la carrera de alguien así sea más o menos esplendoroso nos importa a muchos un huevo.

7 midilibr, día

Grande el post de frjparen, que razon llevas !
Juanma, no tienes nada que decirle a Shuster ?

8 wsmith, día

Ya josecho,

pero las críticas a Raúl, cuando metía 25 goles por temporada, no ahora que no juega y es muy fácil.

La comparación con los políticos... algunos están ahora luchando contra la dictadura de Franco, en vez de hace 40 años.

9 ostane, día

frjparen,
gracias.

juanma,
tibio, tibio con Bernardo. Faena de aliño. Ni que tuviera más cuernos que un pablorromero.

10 kufisto, día

BB

Bernardo es colaborador estrella de papito Abellanah, ¿es que no lo entendéis chicos?; para salvar la cara quizá le dé una collejita cariñosona, ¿verdá juanmanolo?

¡y te ha mentado al archipámpano de la HISTORIA DEL MADRÍ! ¡EL MEJOR! (Joker-Nicholson a Rubiete en el genuino Batman).

Cagancho en Almagro quedó mejor que tú manolillo...

11 elmarque, día

Nunca he hablado mal de nigún jugador,no me he metido en polémicas de si Raul si ó no, todos tenemos nuestra historia y parece que la de Raul como jugador blanco está llegando a su fin.

Pero hoy, después de leer la lista más o menos oficial de los jugadores que van a ir al mundial, me parece una auténtica marranada que un jugador como Raul, viviendo sus últimos días como jugador, no sea llevado a la selección, es como darle el Oscar por toda una vida, y en caso de llegar a la final darle los 10 minutos de gloria que creo que se merece.

Pero nó, como va el zampón de Vicente a mover lo políticamente correcto, hará mejor papel Güiza, o el carnicero del Valencia, ese que da patadas hasta con las orejas.

Para aclarar términos siempre he sido más Gutista que Raulista, pero al cesar lo que es del cesar.

12 cocoom, día

Don Juanma, buen post, pero algo manido, ¿no?.

Eso sí, se le echa de menos en la "arena" (Lo siento ayer comencé a ver Spartacus y algo se me ha pegado (espectacular Lucy Lawless, más conocida por Xena)).

Sangre y honor, Líder, ah... y arena.


josecho6

Voy a cogerte la frase por pasiva, si me permites:

"Si los políticos han de aguantar carros y carretas...".

Aquí los que mantenemos en pie el tenderete no contamos, ¿no?. Bieeeeen.

Esos señores "juegan" con el dinero de tod@s, que, como bien dijo la Maleni, no es de nadie.

Los furgolistas, aunque no todos, juegan con el dinero de los socios de sus clubes. Alguno hay que también con el de las AA.PP., pero, mayormente, con un capital "privado".

A cada uno, lo suyo.

salu2

13 flintoff, día

Iago (del otro hilo), en la premier, los arbitros se saben 2 o 3 días antes, no estoy seguro con que antelación lo saben los propios trencillas, pero a pesar de que tambien hay cosas raras, (todo el mundo sabe que es muy dificil que piten un penalti a favor del visitante en Old Trafford y si el ManU va mal, los partidos duran mucho), la cosa suele funcionar con más naturalidad: los árbitros hablan, reconocen que se equivocan, etc..
Y estoy de acuerdo contigo, lo de los 10 días me parece una exageración, aparte del runrun de la gente y los periodicos,¿que pasa si Itu la monta este jornada? ¿le siguen dando el partido de la semana siguiente? es ridículo, que le castiguen sin pitar como si fuese un jugador en baja forma.

14 erzuru, día

Estimado Iago, lo que describes del sistema inglés sería lo ideal. Al árbitro del partido aquel del balón de playa, lo bajaron ipso facto a la segunda inglesa. Tal hecho aqui es impensable.

En España el tema del arbiterío está viciado desde hace muchos años. No sé de donde viene ni quien es el culpable. Sí sé quién es el que históricamente más se ha quejado, de tal manera que consiguieron que un árbitro, que estuvo en activo varias temporadas en primera división hasta su muerte, solo les arbitrase un unico partido de liga. Todo ello porque el mencionado árbitro cometió la osadía de equivocarse en su contra en una eliminatoria de copa del Rey contra el rival más odiado.

Decían que les habían perjudicado mucho, bueno lo decían y lo siguen diciendo. Esa actitud que tanta les perjudicó en su momento, misteriosamente ha cambiado. Ahora acusan, a los que tienen la osadía de alzar la voz, de llorones por hacer lo mismo que ellos hicieron durante lustros y lustros. De hecho, con una jeta cuya dureza rivalizaría con el más duro pedernal, cada vez que hay algo que no les cuadra, vuelven a sacar sus pañuelos moqueros, se quejíos y sus portadas. Y en estas estamos.

Amigo, esto es la guerra del arbiterío, de las influencias y del yo la tengo más larga. Tal y como se han puesto las cosas, casi llegando a la grosería, hay que utilizar las mismas armas que los de enfrente. Ponerse de perfil, solo sirve para te lluevan las ostias o te quiten alguna que otra liga en Tenerife.

Desde que los del As y los del Marca empezaron a dar la matraca con lo del villarato, hemos asistido a algo insólito, a saber: al Barcelona le han expulsado, justamente, a dos jugadores en su propio estadio, pitándole un penalti en contra, cosa no vista desde hace ni se sabe cuanto tiempo; que perdiera un partido arbitrando Iturralde...y recuerdo: hasta dicha fecha, la cosa era 30 partidos arbitrados y solo tres perdidos.

¿Portadas hablando de Iturralde?...si pueden ser 20, mejor que 10.

15 Metalmad, día

Coñe cocoom, viendo Spartacus??

Procura que no haya niños cerca..., es una serie subidita de tono, jejejeje

16 ostane, día

erzuru,
amigo, permíteme una puntualización: no era una eliminatoria de Copa del Rey, era una eliminatoria de Copa del Generalísimo... ese mismo al que le retiraron la insignia que le habían impuesto años ha.
A Mejuto, muy querido desde ayer en UK, nos lo reservarán para el día del Valencia.

17 cocoom, día

Metalmad

La veo on-line, aprovechando que estoy fuera de casa.

Me gustan las de "romanos", es una debilidad

No hace falta gran nivel de inglés, aunque está subtitulada (el segundo capítulo, muy mal subtitulado, por cierto). Tienen una dicción bastante nítida, incluso en escenas que no se prestan a ello.

Una pena que no la puedan ver los niños, por el contenido erótico de determinadas escenas, alguna vez traído por los pelos y, en otras, por el alto contenido violento.

Sería, a mi modo de ver, una muy buena serie para "engancharte" a la VO y aumentar el nivel del idioma de la Pérfida Albión.

Jane Eyre, VO de la BBC, me parece perfecta para estos menesteres, es decir, seguir perfectamente una VO.

Voy poniendome al día en 24.

No descartes que Jack Bauer aparezco por el blog, ¡ja!

18 HeiaSafa, día

Atrasos:

Bryson, ánimo con la muela y las sucesivas visitas al dentista (nunca basta una sola)

Tudemial, muy curioso el soneto



Avisadme si llega Bauer, que no me gustaría estar de invitado en ninguna aparición suya...

Por cierto, ¿cuántos de vosotros habéis pensado alguna vez la pedazo de serie estilo 24 que se podría hacer con el 11M? Es que se ajusta a todas las características narrativas de la serie. Lo que da mucho que pensar, por otra parte. La realidad supera a la ficción... otra vez

19 chu4che, día

Juanma

si el problema no es la credibilidad de Schuster,Calderón,etc....,porque hayan dicho antes todo eso que usted cita no significa que sea mentira lo que dicen.

el problema es que hay alguna persona o personas que en este momento les interesa sacar estas cosas (si es que sucedieron) o se están inventando todo esto para perjudicar la imagen de Raúl. la cuestión es porque ahora o quién está detrás de esto.

lo que nos debería importar es que se obtuviesen pruebas sobre todo lo que se está diciendo (si es que existen) y sino hay pruebas,desprestigiar a estos dos individuos.
Además,que importa ahora todo esto?????? lo que nos debe importar es el presente.

se está siendo muy injusto con Raúl,uno puede criticarle cuando ha estado mal,etc...,pero de ahi a mentir sobre él o sus acciones va un trecho largo.
el problema es que esto calará en mucha gente aunque nunca se demuestre nada,un poco como lo de Michael jackson con los niños o la teoría oficial del 11-M que por cierto se desmorona.

20 cocoom, día

Grande, grandísimo Higuaín.

Ha estado señor, con los suyos, con los rivales y torero (aunque no le gusten los toros), muy torero. Estuvo muy azuzado por Pedrerol, pero me gustó mucho la forma de no recular a tablas del argentino y mantenerse en los medios.

Para mí nunca lo estuvo, pero ahora mismo, después de ver este pim, pam, pum, no me parece un sobrevalorado.

Lo de bluf, de momento, ya nos ha demostrado que no es así.

Ah, a Bernie Limón, con sus silencios, ya le dijo bastante.

21 morlako, día

Lo más curioso es que, a todo esto, Raúl nunca ha dicho nada en público al respecto.

Ni Guti.

Será porque no se enteran, o porque les da lo mismo, o por lo que sea, pero nunca salen llamando mentiroso ni a Schuster, ni a Calderón ni al Oso Pinone.

Y tienen que salir los periodistas proraulianos, tipo Juanma, a recordarnos la poca credibilidad del personaje.

Calderón será todo lo poco creíble que se quiera (yo sigo y seguiré pensando que le "hicieron la cama"), pero en su etapa como presidente del Madrid estuvo al tanto de información de absoluta primera mano al respecto. Y otro tanto con Schuster.

Y conste que ni me creo ni me dejo de creer nada, pero me parece de lo más lógico que si a Raúl le tienen "vetada" la entrada en la selección Villa y alguno más, Raúl les devuelva con la misma moneda.

Abajo los giles, que de que son ladrones sí que hay pruebas (y sentencias del Supremo, además).

22 dienekes, día

El oso Pinone, morlako

Ése sí que era grande, je, je

23 Hegemon1, día

Letrado Juanma:

Gracias por su exposición....

Ahora, como Alan Short me dirijo al jurado:

Señores del Jurado, se equivocan ustedes si el acusado aquí es Raúl...es más, yo no veo acusados...¿los ven ustedes?..¡¡yo tampoco!!...tal vez si haya uno....¡¡el testigo!!...un tal Shuster....todos lo conocen...jugador internacional de prestigio, entrenador de fútbol una vez retirado y que el señor abogado Juanma ha defendido aquí en sus inicios como Mister del Club Blanco....pero eso es otra historia.
Menciona aquí a un tal Calderon, ex-presidente del Madrid, archijuzgado y condenado por todas partes...rescate desesperado del pasado para tapar las miserias del presente....

Aquí, repito no hay condenado, y el que por tal se considere yerra, y el que busque al acusado por una tal fiscalía inventada, también se equivoca....Aquí señores del Jurado, sólo se ha sacado a la luz una opinión, un comentario de Shuster (no se si de Calderón) que confrimaba algo que en muchos y muchos tenían en mente y lo habían dicho....

Pero algo me llama la atención señores del Jurado...tanta defensa, tanta irracionalidad, tanto fundamentalismo, tanto victimismo para defender a una persona que, repito, no está siendo atacada y que el mismo no se ha pronunciado para desmentir o afirmar las poléemicas declaraciones en la COPE.

¿Por qué Raúl, o Guti no salen a desmentir la cuestión?

Muchas gracias....no les pido ni culpable ni inocente sino sensatez....y honradez.

24 morlako, día

Ahora bien, es cuando menos llamativo que Raúl pase de titular indiscutible a jugador suplentísimo que entra sólo en partidos "decididos".

Que si, que está mayor, pero... Casi igual de mayor estaba hace tres meses, y salía de titular. ¿Qué pasó? ¿Le arrebataron el Anillo Único, como le paso al gran Bilbo y se volvió viejo de pronto?

En fin, que a mí me da igual. Que se preocupe quien quiera...

25 taros, día

Pues yo no estoy de acuerdo en absoluto:

Spartacus es una autentica bazofia. Testosterona y más testosterona.


Ah, lo de Raul...bueno, ya no juega mucho. Y ya está.

26 Hegemon1, día

Cualquier momento es idóneo para sacar los temas que repercutan en el funcionamiento del Madrid. Si ahora mismo la delantera del Madrid no está tan bien, por mucho que juegue Higuain, Benzema no encuentra su sitio (yo le he defendido y le sigo defendiendo) y este verano y antes se quiso fichar a un delantero como Villa y no se hizo por "la carraspera de Shuster"....¿por qué no vamos a hablar de ello?

¿Es tan extraño que en un vestuario, algunas vacas sagradas se opongan al fichaje de un jugador?..¡¡joer!!!...¡si se han opuesto a entrenadores como no se van a oponer a fichajes de jugadores que les pueden hacer sombra!

¿Sólo en el Madrid hay estos problemas?...¿Si las declaraciones fueran de Cruyff en vez de Shuster y se dirigieran al vestuario Culé se hablaría de la misma forma que se habla de este tema en el Madrid?

Lo dudo....

27 morlako, día

Vaya hombre, vuelve el villarato al blog.

El día que se vaya Villar y las cosas sigan como están, ¿de qué hablaremo? ¿de villarato en la distancia? ¿de que Villar dejó sus delfines en la FEF y que por eso todo sigue igual? ¿de que el Jefe de los árbitros es vecino de un amigo de la cuñada del portero de la urbanización donde trabaja el jardinero del testaferro de un negocio agropecuario que la hermana de Villar tiene en Guinea Ecuatorial?

Si es que eso de justificarse en los árbitros es el cuento de nunca acabar...

28 frjparen, día


Querido Juanma, pongo en tu conocimiento las dos palabras que ha utilizado uno de los cinco futbolistas más importantes del Real Madrid para definir a Schuster por su “delicadeza” en el caso Raúl.

Él es Don Amancio Amaro Varela con quien se inició además el mito por el “7” blanco, el dorsal más importante y simbólico del Real Madrid, que luego fue heredando Juan Gómez, Emilio Butragueño y por último Raúl González.

Hace una hora aproximadamente en el programa radiofónico Fútbol es Radio de Es Radio Don Amancio Amaro a dicho textualmente que Bernie es un “graciosillo cobarde” por lo que ha declarado, por cómo la ha hecho y por el momento que ha elegido.

A mí no me ha quedado más remedio que ponerme de pie y aplaudir, sí señor.

Genio y figura dentro y fuera del campo, una referencia de nuestro gran club y todo un caballero.

PD: Eso es defender a alguien, cortito y al pie como no podía ser menos viniendo del jugadorazo que viene.

29 Aliocha, día

A mí también me ha gustado mucho la entrevista a Higuaín, sensato y humilde como siempre.

Y no creo en chismes de vestuario, vamos, que la causa se ha desestimado por falta de pruebas y por la escasa credibilidad de los testigos.

30 erzuru, día

Cierto amigo Ostane, siempre al quite.

31 morlako, día

En el tema de los árbitros, ayer, en un programa de Radio local, hablaron de los últimos arbitrajes de Champions.

En ese programa son (o me lo parecen a mí), bastante ecuánimes, sobre todo teniendo en cuenta lo contaminado y corrupto que es el futból en este país.

Pues bien, decían que ya estaban siendo muchos fallos en cadena, y que el juego ha evolucionado tanto, sobre todo a nivel físico, que los partidos transcurren a velocidades que hacen imposible al árbitro ver las jugadas de cerca, aspecto clave en esto de pitar bien.

Hacían referencia sobre todo al supuesto penalti que le hizo ayer Samuel a Kalou, jugada en la que tanto el árbitro como el juez de línea estaban mal colocados.

No sé, al menos a mí, me ha hecho pensar.

De todas formas, el problema es que son "mu malos".

32 Aliocha, día

frjparen

Totalmente de acuerdo con Amancio, ha definido a la perfección al teutón sureño.

33 ojalanci, día

Si Raúl tuviera que salir a desmentir todas las barbaridades que han dicho de él durante todos estos años, no haría otra cosa en la vida.

Saludos

34 morlako, día

Qué caradura el gordo Rebaño.

Ahora resulta que hay que pensar en el fair play contra los equipos ingleses, y que para eso están Madrid y Barça.

Debe ser que Abramovich es idiota, o el sultán o jeque aquel del City no tiene dos dedos de frente... Y lo que quiere es despilfarrar millones a lo pendejo.

35 morlako, día

Hombre, ahora que no juega tanto, podría aprovechar, ojalanci.

(Sí, soy muy cruel).

36 Metalmad, día

Cocoom:
Yo todas las series las veo en versión original.

Gana muchísimo más ver una serie en versión original.

Taros:

Tanto como bazofia no se..., la serie no es buena, pero bazofia...

37 Iago, día


Erzuru, decías esto unos posts más arriba: "En España el tema del arbiterío está viciado desde hace muchos años".

Sí, pero con matices, en España no está viciado el arbitraje, está viciado todo el fútbol, no sé el caso de otros deportes, pero en el caso del fútbol no es de recibo que sean miembros de una federación gente como Gaspart, Cortés, Calderón etc etc . Todos ellos ex- de algún club que se tuvieron que marchar dejando un infausto recuerdo.

Opinaría lo mismo si el día de mañana se trata de Florentino o cualquier otro ex-presidente del Real Madrid, pero a santo de qué, que se les debe a estos señores, cual es el motivo para mantener en la federación a una serie de exdirectivos, expresidentes de unos clubs determinados. Algo parecido ocurre en la LFP.

Esto es bien sencillo, en la Federación y en la LFP tiene que haber representación de todos los clubs, de acuerdo, pero señores estos representantes no pueden pertenecer a anteriores directivas. A usted se le acaba el mandato, le echan sus socios o su consejo de administración nombra otra directiva, usted lo que debe hacer es recojer sus bártulos y a su casa.

Pero no, por los intereses que sean, a Villar eso no le interesa. Ejemplos como el de Calderón, echado a gorrazos de la presidencia de su club y se le da un cargo en la Federación, no sería más lógico darselo a un vocal, directivo etc etc de una junta directiva én vigor.

Barrunto movida en la federación como gane Rosell las elecciones en el Barcelona, obviamente éste querrá infiltrar gente suya. El Barcelona ya tiene a Gaspart ahí dentro, para Laporta algo habrá, y al chico que envíe Rosell, ¿ Que hacemos con él?

El caso de Pedro Cortés, delegado de la selección española.¿ Qué méritos ha hecho este señor para tal cargo ? ¿ A quién le debe guardar silencio?

Obviamente todos estos cargos están pero que muy bien remunerados, con sus dietas, sus viajecitos y a vivir del cuento.

Todo lo que rodea a la Fedeación y a la LFP está podrido.

38 ojalanci, día

morlako,

Eres malo... En serio, supongo que Raúl debe considerar (y yo con él) que no hay mayor desprecio que no hacer aprecio. Por eso no ha bajado nunca al fango. De hecho, creo que es uno de los motivos por los que la prensa lo ha calumniado tanto: jamás les ha dado vidilla. Y me parece bien.

39 Hegemon1, día

33#
Excusa barata...no me vale....

40 Hegemon1, día

28#

Amancio lleva mucho tiempo fuera del vestuario...le honra defender así a un jugador del Madrid y a la Institución, pero que él tenga una opinión personal sobre Shuster, no desacredita a este ni desmiente lo que el alemán ha afirmado, es más...¡¡¡Amancio no ha desmentido lo dicho sólo que no era el momento ni la forma!!!!....¿Amancio sabrá algo que se calla? ¿Asumirá que las declaraciones de Shuster, a pesar de lo inoportunas y del personaje que las dice, son verdad?

Además, el programa de Luis y de Deater es también raulista....

41 Hegemon1, día

¿Desde cuando Raúl no ha bajado "al fango" para desmentir algo?

Recordemos que muchas veces Raúl ha tenido que desmentir, matizar o declarar algo que se ha publicado en la prensa.....

Como bien dice arriba Juanma, si un Presidente tiene que contar con los capitanes para fichar a alguien, ¿cómo dijiste Juanma?..¡¡ah si!!.."Mal hecho por parte de Calderón"...¡¡¡y por cualquiera Juanma!!!....y si shuster, el entrenador quería a Villa y se opusieron en el vestuario, es algo muy grave que un madridista debe denunciar....los que no son madridistas son aquellos que no quieren que se sepan las cosas...sssshhhhh!!!...que se trata de Raúl....silencio.....

42 dienekes, día

Acabo de ver la entrevista a Higuain, un tío la mar de sensato.

Pero qué impresentable es el fulano del Pedrerol, dios.

43 morlako, día

Pues yo no lo veo tan mal, Hegemon1.

Que un jugador no quiera a otro como compañero es de lo más normal. Pasa en todos lados.

Si uno trae a un jugador a un grupo, el cómo encaje en ese grupo es clave. Si de entrada ya se sabe que se lleva mal con uno de los que tienen la voz cantante (porque llevan allí varios lustros), la cosa es muy raro que vaya bien.

Ahora bien, creo que la opinión general del blog es que Villa no fue al Madrid porque el tal Llorente quiso sacarles mucho más pasta a 2.0 de la que el jugador "valía". Escandaloso.

Por cierto, ¿cómo está la situación económica del Valencia? ¿Mejora?

44 cocoom, día

taros #25

No he dicho que sea bazofia o no. Coincido en lo de la testosterona, pero, es "una de romanos", dónde, precisamente, siempre aflora la testosterona.

En este caso, más evidente, porque ahora se estila más el sacar cosas en pantalla que, antaño, estaba mal visto sacarlas.

A mí me gustan las de romanos.

morlako

Tú opinion es irrelevante :PPPPPPP

Hablando en serio, en este caso, Calderón ex-presidente del Real Madrid, ves la viga en el ojo propio (Cerezo-Gil), pero no ves más que paja en el ajeno.

Calderón será un Presidente de infausto recuerdo para el madridismo, excepción de cuatro acólitos irreductibles, en "todos" los temas que puedas imaginar, excepto en haber ganado dos ligas.

ojalanci

Es más, yo les respondería a los periodistas lo mismo que Guti, "a por amapolas"

dienekes

Pedrerol es... llámale x

45 alber130, día

Hegemon1, lo único que faltaba ya es que vengas aquí a darnos clase de madridismo.

Paso ya de todas las estupideces que escribes sobre Raúl, sinceramente después de tantos posts he llegado a la conclusión de que lo tuyo es una fobia que está fuera del alcance para nadie, salvo que uno se dedique a la medicina y le permitas que te trate, solucionar, pero que además te atrevas a darnos lecciones de madridismo por no estar de acuerdo con las sandeces que escribes es el colmo.

Por no hablar de que en otros posts te atreves a cuestionar la inteligencia, formación y nivel cultural de las personas que discrepan contigo. ¿De dónde has salido? ¿Quién te crees que eres? ¿Cómo eres tan osado de hacer algo así sin tener ni idea sobre la vida y milagros de las personas a las que inútilmente tratas de ofender?

46 ojalanci, día

cocoom,

Es que Guti da mucho juego, y no sólo en el césped...

47 morlako, día

Dos ligas no es poca cosa, cocoom.

En cualquier caso, está por ver cuán capital fue su aportación en la consecución de esos éxitos. Aunque esto se puede decir de todos los presidentes de clubes de fútbol, claro (salvo algún presidente-jugador que haya en Libia, i.e.).

Por lo pronto, con él llegó Capello.

48 cocoom, día

morlako #47

En realidad no es poca cosa no señor, pero, a mí como madridista, no socio, ese tipo me da grima.

Si ya fuese socio y, además, con posibles, este tipo no iba a tener vida suficiente para pulular de juzgado en juzgado.

Hablando de juzgados, estos irán dictando sentencias poco a poco y, entonces, podemos aplaudir o envainarla, dependiendo del veredicto.

Eso sí, todos sabemos de muchos "inocentes" de sentencia que son culpables hasta los tuétanos.

Verbigracia, los actuales dirigentes del ATM.

Que la animadversión hacia FP no te ciegue un buen juicio :P

49 Hegemon1, día

Morlako:

Según tengo yo entendido, aún estando Shuster como entrenador, el Madrid y Valencia tenían un acuerdo por Villa. No me parece descabellado porque ahora sabemos que tenían a Ronaldo atado...¡¡por una pasta!!!....según parece, y no sólo lo se por Shuster, sino en su día se dijo en algunas tertulias de radio que alguien del vestuario, alguien del Madrid, o la Directiva, o Raúl o quien sea dijo que no lo quería....se fué al garete la cosa......en verano Florentino volvió a por Villa, porque Florentino pasa de Raúl y quiere quitarle poder, pero el Valencia estaba mal economicamente, se cambia de Presidente, no quiere entrar desmantelando al club....etc....

Eso es lo que yo creo que pasó....¿¿¿Fobia?? pues no, lo que pasa es que siendo madridista me parece mal, muy mal que por estas cosas salgan los fichajes más caros, no salgan y que jugadores de la talla de Villa no vengan al Madrid...¡¡es un caso grave!!...el que no le guste que se rasque, pero es un caso grave que cualquier madridista debe discutir, esclarecer y no tapar, porque el mal sigue ahí....

50 Azulon, día

Haegemon 1

¿Tu eres consciente de que estás escribiendo tus post en un Blog que se titula “El penúltimo Raulista vivo”?

Te voy a poner un ejemplo que, por extremo, es ilustrativo. ¿Tú has probado a ir a una Mezquita a decirles a los allí presentes una verdad histórica e irrefutable, como que Mahoma era analfabeto, un asesino y un ladrón de caravanas?. Pues prueba. Si sales vivo, llegarás a la acertadísima conclusión de que has ido a predicar al lugar equivocado.

51 Hegemon1, día

45# Albert:

A tus inquietudes sobre mi:

"Por no hablar de que en otros posts te atreves a cuestionar la inteligencia, formación y nivel cultural de las personas que discrepan contigo"

Antes que yo se me cuestionó a mi, como ya he dejado bien claro. Me han tacahdo de todo....sin que yo me metiera con nadie...

Me preguntas....


¿De dónde has salido?
Del mismo sitio que tú

¿Quién te crees que eres?
No menos que tú ni que nadie.

¿Cómo eres tan osado de hacer algo así sin tener ni idea sobre la vida y milagros de las personas a las que inútilmente tratas de ofender?
Osadía que he copiado de todos los participantes de este blog...que para eso es un blog de opinión. Tú eres tan osado como yo...¡¡o más!!!...tienes que preguntarte porqué te sientes ofendido porque yo participe en este blog y tenga una opinión propia.

52 Hegemon1, día

Azulón:

¿Estas sugiriendo que este blog es una mezquita, es un sitio de fundamentalistas?

Esta mañana se me ofendieron por llamarles "talibanes raulistas", un apelativo que no pretendia ofender, pero no resultó...a mi me han llamado de todo, ignorantes, sopla.pollas, y otras lindezas...

No creía que este blog no fuera de libre opinión...en tal caso se me debe informar...yo creía que aquí podía opinar cualquiera, sobretodo del Madrid...¿no es así?

53 Azulon, día

Veo que no lo pillas. Con tu permiso, desisto.

54 Hegemon1, día

Si, lo he pillado....pero las preguntas son para aquellos que no lo pillan de verdad....

Esta mañana los raulistas decían que "Raúl y Ronaldo" fué una pareja letal......sin ser raulista creo, el mayor daño que sufrió Raúl fué el fichaje de Ronaldo. Le desplazó de su sitio, le quitó del sitio donde más efectivo era Raúl, le hizo perder confianza y bajar su rendimeinto...y ahí estan sus números.

Además, Ronaldo fué una mala influencia en el vestuario. Fue un alivio para Raúl que se fuera....

55 Iago, día

No por esperada deja de ser sorprendente, pero han detenido a un camello vendiendo sustancias adulteradas.

Que le vamos a hacer.

56 morlako, día

Qué va, cocoom. Estás confundido.

Los giles, en la sentencia del Supremo de marras, fueron declarados culpables de apropiación indebida. Y no fueron al talego por prescripción del delito.

Sutil diferencia, pero letal para los intereses del club de mis amores.

Calderón tiene un chorro de juicios pendiente, pero como abogado que es, supongo que saldrá librado de prácticamente todos. Si alguno quiere llegar al Supremo apelando, habrá que verlo.

57 wsmith, día

¿Esto es un deja vu?

58 morlako, día

No parece bueno el ejemplo de la mezquita, Azulón. Ya puede ser todo lo metafórica que quieras.

Por esa regla de tres aquí no debería entrar nadie a opinar.

59 Azulon, día

Morlako, craso error. Leete sábana de ayer y hoy.

Y espero que tu Atleti, pase la ronda.

60 wsmith, día

morlako

El once inicial del conjunto rojiblanco es: Asenjo; Valera, Perea, Ujfalusi, Antonio López; Assunçao, Raúl García, Reyes, Simao, Jurado; Agüero.

QSF no saca dos delanteros ni teniendo que ganar obligatoriamente. Mal os veo esta tarde.

61 morlako, día

Completamente, wsmith.

Es otro de los temas hit de este blog. A saber:

- Villarato. ¿Bueno, malo o regular?
- CR. Caro, muy caro o ajustado a la realidad. Barato incluso.
- Superatletismo.
- Raúl, mal endémico. No jo.damos.
- cule provocador y bufón. Plof.
- guerra de las galaxias barça-madrid.
- ...

En fin, os dejo por hoy.

62 cocoom, día

wsmith

Se comenta que Ferrari esta jugando al gato y al ratón, que tienen bastante avanzado el GP de Bahrain y que andan un paso por delante.

Andan dándole vueltas a la "tuerca" de Ferrari, al flujo del aire del MP25 y a un dispositivo mecánico de elevación en boxes de Mercedes GP, es decir, "alegalidades" como lo del año pasado del doble difusor.

Se habla del nuevo capó de Ferrari, que termina similar al de McLaren, pero no he visto fotos todavía.

Mañana es el día. Sábado y Domingo dan agua a mansalva.

63 cocoom, día

wsmith

Jurado es delantero o segundo delantero o mediapunta.

Otra cosa es que lo pongan de centrocampista, que, ahí, para mi gusto, no rinde.

Yo veo un 4-4-1-1 claro

64 morlako, día

A mí lo que me da miedo de ese once es Antonio López. Es muy peligroso ese tío. Ojalá Valdano se enamore de él.

No me extraña que cuiden a los delanteros, wsmith. El Atleti es el equipo español que más partidos lleva jugados hasta la fecha en esta temporada. Y es de los que primeró arrancó con la alta competición.

Y con el Mundial en ciernes...

Ahora sí que sí.

65 wsmith, día

cocoom

Sí, estoy de acuerdo. Al parecer, esta mañana, con el coche en el garaje 2 hora seguidas, estaban tan tranquilos. Por eso decía lo de si estaban esperando.

En las fotos que hay hasta ahora no se termina de ver bien el capó, pero sí que parece que la aleta es más alta en la raíz:

http://estaticos02.marca.com/deporte/motor/formula...

66 Bryson, día

El tema este de Raúl-Schuster-Villa-Calderón en casa de Abellán, no me importa nada en absoluto. Lo siento. Voy a hacer un esfuerzo... ¡mmffff...!

No, sigue sin interesarme. Mis disculpas.

67 wsmith, día

cocoom

Jurado en vez de Forlán... Hombre, no hay color. Teniendo que ganar dejarte tu mejor jugador en el banquillo... Que le hubiese reservado contra el Almería.

morlako

Ya pero el Atleti tiene que ganar sí o sí para seguir en competición. Me recuerda al partido de vuelta de Oporto del año pasado donde Abel se dejó también a ¿Agüero? en el banco y jugó con un solo punta.

68 wsmith, día

Que no Bryson, que es muy interesante. Mira:





Ah, no, no es interesante.

69 Bryson, día

¡Ah, cogno! A las 19.00, dos partiditos, los dos Atletiss. Bueno, otra cosita es. Empezaré a verlos.

(¿Que ha dicho un ex-entrenador al que caracteriza la soberbia que un ex-presidente imputado por tropecientas cosas le dijo que un jugador-grupo de jugadores vetó a nosequién? A mí plim, yo duermo en Pikolin...)

70 Bryson, día

El otro día, un dermatólogo muy famoso (en su casa a la hora de recoger la mesa), aconsejaba la utilización de ropas de... bueno, no sé si de algodón, lino, o látex. No me enteré. Evitaba la formación de nosequé tipo de eczema que picaba como ortiga en testículo, porque favorecía la evaporación del sudor. O del vello púbico. Ni p.uta idea.

No me enteré, porque no le presté atención.

Pues el tema de Abellín y las toses del rubio que ya quisiera él ser andaluz, igual.

¡Mmmffff....! No, nada de nada.

71 alber130, día

Hegemon1,

Para ti la pe.rra gorda.

Lo tuyo es grave. Y aunque no te lo creas, de verdad que lo siento.

72 Azulon, día

El Atleti va a jugar hoy bajo un aguacero. El equipo rival parece preparado para ello

http://staff.tibiahispano.com/equip-futbol.jpg

73 Bryson, día

Azulon

Me pido jugar ese partido, y exijo marcaje individual. Encima, vamos.

74 cocoom, día

Bryson

Pura delicia. Veo que lo de la muela va "achicando". Me congratulo.

wsmith

Hablaban de un capó totalmente nuevo, similar al de Mclaren, con aleta de tiburón terminando en el alerón trasero.

No recuerdo dónde lo leí.

75 sebmelmo, día

Ay Hegemon, Hegemon... veo que no has captado la idiosincrasia del bloguero standard de este blog.
?Quieres recibir parabienes sin cuento?...Facil: añade links de tias, hazte pasar por indigena de alguna exotica etnia (los masais no, esos estan cogidos)y escribe algun serial simplon elogiando al madri , y, sobre todo , insulta a algun blaugrana del blog. Cule1899 es lo habitual, pero Sebmemo tambien vale. :):)
Es por todos sabido que Raul tuvo y/o tiene un poder dañino en el vestuario merengue. Alfonso Ussia y Schuster, ex-candidato a la Presidencia blanca y entrenador blanco respectivamente,han denunciado ese poder. De la Seleccion salio precisamente por eso:su afan de entrometerse le granjeo enemistades.
Decirlo levanta ampollas a los raulistas, de modo que yo voto por no decirselo mas,puesto que ya lo saben, y tener la fiesta en paz.

Salu2

76 Hegemon1, día

Albert130:

Un fuerte abrazo amigo......cuidate.....que te vaya bien....muaaaccccc!!!!

77 Hegemon1, día

75# sebmelmo:

Puede que tengas razón.....no es mala idea...pero si hago eso no sería madridista...no sería nada....

78 Bryson, día

Ya tienen trabajo Valdano y Pardeza. Lukaku, 16 años, 1,90. El nuevo Drogba, vaya bestia parda. Acaba de hacer una carrera por la banda de las de quemar el césped.

Es del Anderlecht. Pongo enlace de tía.

http://www.fstage.com/hirek/420/Amanda%20Righetti_...

Por cierto, gol de Lukaku

79 COPELAND, día

Todo esto me recuerda al título de la famosa novela llevada al cine, "La insoportable levedad del ser".

1º.- Desde hace uno cuantos meses, gracias a Pellegrini, Raúl y el resto de la plantilla, el caso Raúl ya no existe. Gracias a todos, como madridista.

2º.- Schuster es un carcamal. Quedo clarísimo lo que dijo pero no se atrevió a afirmarlo rotundamente. Lo cierto es que el Marc, entonces Marca no sacó a Villa vestido de blanco con la camiseta del Madrid. Tampoco el As(no).

3º.- EMHO, Villa debía haber sido fichado por el Madrid. Fue un fracaso que no ocurriera así para el Madrid, para el Valencia y para el propio jugador. Recuerdo el ridículo de Abellán cuando salió en anrtena diciendo que estaba hecho ... con el Barça, para tener que desdecirse al poco tiempo, extrayendo cuidadosamente la extremidad que había insertado hasta la ingle.

Mira que me gustaba Abellán, el único que le echó narices con el multiimputado y con el EGM. Pero desde que está en la órbita de la Secta y le pone el felpudo a FuchInda, no hay quien le soporte. O al menos, yo no le soporto su antimadridismo rancio, primario y absurdo, más propio de la prensa de la Provincia nororiental del Reyno de Aragón.

En, fin todo esto es buena señal, Calma chicha en el vestuario y en el club, que es el mejor ambiente para conseguir grandes éxitos. Pellegrini calla a sus unánimes enemigos mediáticos con juego, goles y un vestuario unido.

Este año, doblete.

80 Hegemon1, día

COPELAND:

¡¡¡Dios te oiga!!!.....y si no pueden ser las 2 que sea la Copa de Europa..me conformo con la 10ª....aunque lo veo difícil....

81 Bryson, día

Muchos cataplines el ATH. Al Lukaku ese, ya deberían estar fichándolo.

Pongo enlace de tía. Mila Kunis, un poquillo seca, pero guapísima.

http://top-people.starmedia.com/tmp/swotti/cacheBW...

Le echo un vistazo al ATM. Despedimos la conexión, paso a estudios centrales, puritos Reig, el purito.

El purito que le metieron a Il Simpático Etttore el domingo. ¿Ha dimitido? ¿No? Pues ya está tardando

82 wsmith, día

Por si queréis ver al Atleti en SopCast, canal alv1172

83 Bryson, día

Otro gol del Anderlecht. ¿Quién lo fabrica? Sí, efectivamente... Lukaku. Qué barbaridad.

http://pocus.files.wordpress.com/2008/10/laura_pre...

Otra tía, claro

84 Hegemon1, día

¡¡¡¡Ahora entiendo muchas cosas!!!!


El tema no da para más......por la sencilla razón de que la gente se enfada no por lo que haya dicho Shuster, que sospechan que sea verdad, ¡¡¡sino que se haya atrevido a contarlo!!!..precisamente Shuster, que es un poco bocas y veleta.....pero sospechan, o casi están seguros de que lo dicho sea cierto.....pero...ssshhhhhhh!!!!...¡¡¡que no se diga!!!

Ese es el problema.....me voy a cenar.....

85 Iago, día

Buen provecho

86 cule1899, día

caramba, carambita, carambirurí ... otro troll en el blog ... que ilusión ... y a la vez, que decepción (eso quiere decir que estoy perdiendo facultades :):))

Pregunta a los expertos: si le pregunto algo a hegemon1 ... como es una conversación de troll a troll ... ¿el blog explota?
Contestadme, por fi, porque si no, no dormiré esta noche

Hegemon1 ... no te preocupes ...
Ya discutiremos tú y yo sobre esa afirmación de que Villa es mejor que Ibra ... te diré algún tururú en algún momento ... y volverás a ser de los buenos :)

Azulon: joer ... que comparación con lo de las mezquitas ... :):)

PD: Ibra ... que bueno que viniste. Jejejeje.

87 cule1899, día

Ah, por cierto ... felicidades a los posibles seguidores del Ciudad Real de Balonmano por la Liga ... por otra parte, ya ganada con la victoria de la 1ª vuelta en el Palau.
La Copa para el Barça ... La Liga para el C. Real ... a ver que ocurre en la Champions, aunque veo favorito al Ciudad Real.

In Xavi Pasqual de Balonmano we don't trust (es que el entrenador de Balonmano se llama igual que el de baloncesto)

Por cierto, hoy toca Basket ... juega Madrid en Teledeporte y Barça en Canal 33. Iremos haciendo zapping ...

88 Azulon, día

Lo siento socio, estaba buscando enlaces de tias.

Aquí dos. Dos tias, digo (bueno, creo)

http://4.bp.blogspot.com/_JuX4EDNESoY/SbqRi09E81I/...

89 Azulon, día

Lo del Atleti lo veo chungo.

Esta no se de que equipo es

http://i.ytimg.com/vi/Wq5uxk-B2NQ/0.jpg

90 Hegemon1, día

Ya se que estas enamorado de Ibra, pero yo creo que era mejor Villa para el Barça...pero yo puedo decir...¡¡¡Villa que bueno que NO fuiste!!!

91 Azulon, día

Cule. Pues si, un ejemplo heavy. Pero ni con esas. En fin...

92 tientos, día

Pues yo no apostaría mi dinero a que no fuese cierto este asuntillo. Además, no creo que sea el único caso en el fútbol español, sin ir más lejos hace poco se dijo que Puyol y Xavi habrían puesto de su parte para que no viniese Robinho al Barça en el mercado de invierno. Lo ignoro tambiés si esto es cierto o no, pero extrañarme no me extrañaría nada, además me parece cojonudo, con Ronaldinho tuvimos bastante. Aquí la diferencia que veo respecto al caso Raúl- Villa, es que ni Puyol ni Xavi estarían actuando en benefifio propio, si no en beneficio del club.

93 Dedalus, día

Cule:

No, no explotaría. La mayoría estaríamos dormidicos y a gusto en nuestra caverna (Choza tribal en el caso de Capaldi) mientras los civilizados os peleáis. Debido a vuestra sin par clarividencia y preparación, el debate entrambos se produciría demasiado lejos de las agrestes cuevas donde seguimos, dale que dale, cocinando carne de mamut à la façon provenzale (O sea, con hierbajos, supongo) y pintando nuestras rupestreces varias. Yo me he pasado al abstracto y ahora mis bisontes son líneas paralelas, pero Cocoom me ha echado un broncazo de agárrate y me ha pedido que me mantenga en el arte figurativo. "So jeta", ha añadido.

¡Queremos otro soneto bético! ¡Uno que critique a Lopera, porfa!

94 Azulon, día

Tercero del Anderlecht.

Y pensar que el Madrid no ganó a esta panda

95 morlako, día

Agüero por Forlán.

¿Qué tiene el Kun?

96 wsmith, día

morlako

No lo he visto, pero por lo que he leído le han partido la cara de una patada.

97 wsmith, día

Las dos que ha tenido Reyes seguidas.

98 wsmith, día

Golazo de Simao.

Me cambio al baloncesto. Espero que podáis aguantar el resultado.

99 cule1899, día

Hegemon90: "yo puedo decir...¡¡¡Villa que bueno que NO fuiste!!!"

Totalmente de acuerdo.
Joer, pues si que empezamos bien ... De momento, no hay posibilidades del tururu :):).

azulon91: ¿ya te ha llegado la factura de los tres catalanes? :)

tientos92:
In tientos I trust ... :). Un saludo, tientos ... pero ojo, que meterte con Raúl ...
Por otro lado, si es que este caso no es criticable.
Villa le saca de la selección y Raúl le saca como contrapartida del Madrid. Es el quid pro quo (¿o era al reves?).

dedalus93: jejeje. Buenas tardes/noches, profe. Por cierto, un secretito: en la comida de ayer les expliqué a ropalo y hermanus el motivo de mi admiración al gran dedalus.
Y creo que tienes dos admiradores más ...
¿Tú en la caverna? ... Lo entiendo, eres como Mowgli ... te da pena dejarlos :):)

PD: últimas noticias ... Florentino va a ver hoy el partido Madrid - Montepaschi ... y le han requisado el móvil en la entrada ...
Por si las moscas :):)

100 wsmith, día

J0der, pues sí que le ha durado la alegría al Atleti...

El baloncesto era las 8:30, ¿no?

101 Rojo4, día

Es que ha colisionado con el móvil del director del Barça de balonmano y se han destruido mutuamente. El detector de rayos gamma de Monte Palomar se ha salido de la escala. Le están escayolando la pierna que se ha roto en la caída.

102 wsmith, día

culé,

no viste el balonmano, ¿verdad?

Cuando ayer iban 11-6 en el minuto 29 de la primera parte, Masip estaba en la grada mandando mensajitos por el móvil.

A veces es mejor no hablar tanto, porque luego te pillan en lo mismo que criticas tú.

Saludos

103 Rojo4, día

wsmith: 20:45

104 wsmith, día

Gracias

105 Rojo4, día

Si el Real Madrid ha empezado a recuperar el juego como se vio en la Copa del Rey, hoy debería vencer al Montepachi. El mejor equipo de Italia. Que perdió por veinte en su casa contra el Barcelona. Porque el Real Madrid, jugando bien, está por encima: sólo ganó al Real Madrid por siete, y estuvo por debajo, con el Real Madrid jugando de pena y de pensar seriamente en la destitución de Messina entonces.

106 wsmith, día

Efes 63 - Macabbi 56

Si el Madrid gana cuádruple empate.

107 Hegemon1, día

Pase lo que pase esta temporada Messina debe seguir.....creo que se ha equivocado en algunos fichajes, pero debe seguir...recordemos que el Madrid si ha invenrtido pasta en baloncesto, pero el Barça mucha más....lleva deventaja.

108 Rojo4, día

Ganará el Montepaschi, por hablar. Y por Bryson verlo :P.

El Efes ganó al Maccabi.

El socio nº 1 del Real Madrid murió, y un expreparador físico del Real Madrid de baloncesto. Que en paz descansen, mi pésame a las familias.

109 wsmith, día

Joder, Hegemon

ya era de coincidir contigo.

Rojo4

espero que tu porcentaje de aciertos coincida con el de Juanma.

110 Capaldi, día

http://3.bp.blogspot.com/_lgxYKVOgMHk/Rwr_iXPNFHI/...

Te lo juro de mi madre que esta tiparraca tener los pezoncillos de churri mía: Mirinda. (No confundir con Fanta de serial "Roots"). Guerrero masái agradecer.


[saltos de precalentamiento]

(...)

[saltos ahora más elavados en honor a Hombre Blanco Dedalus, que ser siempre acicate para que masái continuar rompiendo lanza en favor de madridismo]

111 Rojo4, día

Debe seguir, efectivamente, Hegemon1, porque tras Bilbao se vió una mejoría y por tanto una pista de que el equipo puede recuperar la mejoría del juego que se rompió con las lesiones de diciembre (y que ha durado, en mi opinión, más de lo comprensible) y que, por ello, conviene mantenerlo porque es bien posible que con Messina el equipo mejore. Aunque no veo ya que pueda llegar a superar el Barcelona cuando lleguen las eliminatorias por el título.

Aunque para mi gusto, tendrá que verse una clara mejoría mayor para que a fin de temporada me parezca claramente correcto mantenerle la siguiente temporada. Si no, podría estar entre opinable, un riesgo o una equivocación, dependiendo de cómo vaya el resto de la temporada.

112 Rojo4, día

Lalo Alzola está de acuerdo conmigo: del Real Madrid ha dicho "ha renacido de sus cenizas"

113 cule1899, día

wsmith: jajaja. No sabía lo de Masip ... De todas maneras, no son comparables los cargos ...

Hegemon: bien, bien ... empieza lo bueno :)
Para tu info, el Madrid de Fracasado Pérez se ha gastado muuuuuuuuucha más pasta que el Barça de Triunfante Laporta.

114 Hegemon1, día

El Barcelona ha hecho un equipo muy fuerte y atlético. Ha apsotado por un baloncesto más moderno que Messina, que se ha ido por pivots altos, de los de siempre, pero que contra equipos como el Baça, la pinturan no la ven. Sigo pensando que este año debe ser un año de transición. En el baloncesto la cosa es más complicada que en el futbol.....

115 Hegemon1, día

Cule:

debes saber mejor que nadie las cuentas de la sección de baloncesto del Barça. El otro día El Mundo en un artículo desgranaba lo millones gastados por Laporta, 40, mientras que el Madrid sólo 30....la diferencia, siendo baloncesto, es clara.

Vosotros teneis el record del fichaje más caro....¿o no sabes lo que tienes en casa?

116 Rojo4, día

Se paga bien por un abofeteador remoto. Preferido si tiene preferencia por elegir como objetivo gente alta llamada Jorge Garbajosa. Razón, blog de Juanma.

117 taros, día

Gooooool. Y en el último minuto. Mira que me alegro.

118 Capaldi, día

MASAI

[75] y tú quién ser?


(sin saltos)
Te lo juro de mi madre que ver último partido de barsa en bareto de Nairobi, sobre mezcla de albero y peladura de gamba. Y aquí venir lo más importante: verlo rodeado de culés. En Nairobi haber más culés que en poblado masái, cosa lógica por mera cuestión de densidad. Dueño de bareto ser de Songo, conocerlo de vista, y saber que ser culé pues tener banderín azulgrana en botellero, entre el dyc y el Calisay, que aquí ser el último grito en bebidas con graduación. Sí, en algunas cuestiones tener algo de “delay”, ser un poco primitivos, mi admitirlo sin ambages.

A propósito: esta ser última combinación ganadora de primitiva en poblado:
palo,
piedra,
palo,
rama,
rama
y piedra.

Complementario: palo.
Reintegro: piedra.

(Tocarle íntegramente a Gran Jefe de Tribu. Siempre tocarle a él, te lo juro de sus muertos)




(Mi seguir con crónica más abajo) (o intentar, que cuerno de rinoceronte envuelto en papel albal –artilugio que hacer de antena wifi- no cumplir expectativas)

119 Rojo4, día

Ah, los cargos son diferentes, así que no importa.

Supongo que no está tan mal que en una reunión-comida con Obama Moratinos se suene los mocos con el mantel, porque no es el presidente. ;)

120 morlako, día

Pues nada, que estamos en octavos. Hoy tocaba partido "bueno".

Esperemos que lo del Kun no sea para mucho.

Lo malo de ir superando rondas es que al final sufriremos en la Liga. No hay plantilla para tres competiciones. Pero no importa, lo prefiero.

121 Rojo4, día

El abofeteador no tiene que ser específico para el nombre. ¡Qué c@g@d@s han hecho esos tres jugadores! Ese pase, ese no tirar o penetrar, ese perdonar el pase interior y el posterior no correr a amagar tapón.

122 wsmith, día

Siena, 3 triples y 2 tiros libres. 0% de tiros de 2.

El Madrid, abusando del triple y tirando mal. De momento están cerrando bien el rebote. En ataque, un poco espesos. Prigioni, mal.

123 Capaldi, día

Entretanto, Atlético marcar chicharrete en postrimerías, y guerrero masai congratularse por hombre blanco Capi y Hombre blanco Morlako.


Vuelvo a partido del barsa. Como yo ya indicar, bareto donde yo seguir choque ser eminentemente culé. Ser raro: ambiente estar ahí muy muy agriado. “Tantos títulos para esto” –pensar masái pa sus adentros-.L os que no estar ciegos (ni de vista ni de fanatismo), no dudar de que el barsa salir otra vez descaradamente beneficiado. No sé, al final va a ser cierto el bulo de que Hombre blanco Platini ser culé hasta los tuétanos, te lo juro de pedrerol (que parecerse mucho a ave carroñera). De más está decir que culés presentes en el bareto, al terminar partido, quejarse amargamente de la zamorana de un alemán en min69, obviando, naturalmente, que estar precedida de otra mano del arpón sueco, conocido aquí como El Tochas y que en nutrida peña merengue del poblado masai rebautizar como Doña Rogelia nórdica; jugador que crecerse en reyertas pues protagonizar otra más, te lo juro de El Vaquilla. De las otras jugadas, nadie, absolutamente nadie, hacer ni un solo comentario. ¿Cuántos culés haber allí en bareto? ¿12? ¿15? Masái no tener ni idea. Lo único que ser cierto es que cerveza de sorgo estar caliente como suelo de savana al mediodía y que pedir una tapa de pezuñas de órix y servirme suelas de zapato, te lo juro de El Bulli. Verme en obligación de recordar a blogueros que una de las jugadas “polémicas”, el escandaloso penalti de Márquez, suponer expulsión y un más que probable 2-0 en marcador justo antes de terminar primera mitad. Y ahora preguntarme: ¿Con dos goles en contra y un tío menos barsa que dirigir hombre blanco santurrón Pep encarar de la misma forma la 2ª parte? ¿El desgaste haber sido el mismo? Nadie hacerse éstas y otras preguntas tan simples, te lo juro de “Matrix forever”.


(sin saltos)

124 wsmith, día

Enhorabuena a los atléticos.

Mal final del primer cuarto. Sin ideas en ataque.

125 Rojo4, día

Jugadores fallones en ataque, no acertando con las decisiones correctas; pero el estilo general correcto, sin llegar aún a lo que debería ser el estilo para esta plantilla.

126 Rojo4, día

El cierre de la defensa que dice el segundo comentarista se ha propiciado por el exceso de tiros triples que se han hecho y fallado.

127 Bryson, día

No, no pienso ver el baloncesto, ni de cogna. Prefiero ir a moler ajos.

Para mí ese equipo, mientras esté el "simpátticco", no existe. Sencillamente.

Yo soy así.

128 Rojo4, día

No me jo que van a ponerse a imitar la selección de "cuando no tengo ataque claro tiro triple con tres encima" Imbroda.


Pues ya debería haber pedido tiempo muerto.

129 Azulon, día

Capaldi (118). Genial de toda genialidad. Este hay que enmarcarlo.

130 Rojo4, día

El abofeteador que sea apuñeteador, y con puños americanos, por favor.

131 wsmith, día

1 de 10 en triples, aunque han hecho un par de buenos ataques ahora y se han puesto a 1.

A ver Tomic qué hace estos minutos.

Veo que al Barça le están dando bien de momento, ¿no, culé?

132 Capaldi, día

Masai ya cerrar intervención porque enchufe estar quemándose, oler ya a orto de búfalo (te lo juro de carlitos martínez). A ver, lo que ocurrir la otra noche en tierras teutonas no ser lo de Stamford Bridge, a tanto no llegar la cosa, pero te lo juro de mi madre que no quisiera para Madrid de mis entrañas tantísima ayuda arbitral. Ganar así en Europa a este masai causarle enorme sonrojo, dejaría júrgol por larga temporada, durante muchísimas lunas. No en vano, ayudas de ese tipo no hacernos falta en nuestras 9 orejudas; otro sí digo, la historia cuenta que en 1961 robarnos una; verlo perfectamente en mi ordenador amstrad de caña de bambú y rama de acacia con wifi conectao a tamtam; ser atraco muy bien documentado, con lo cual equipo mío podría estar aspirando perfectamente a la Undécima, pero bweno, por lo visto,en aquellos tiempos, estar hartos de apisonadora blanca, de las dentelladas de insaciable león blanco.



http://www.as.com/futbol/articulo/guardiola-hemos-...
Ya que ser el propio Hombre Blanco Guatrolas quien sacar el tema de los árbitros, guerrero masái decirlo con una mano en pecho, con la otra sosteniendo lanza y con la chorra enhiesta: los que creer que en Stamford Bridge no pasar nada o que en Stuttgart árbitro robar por igual a unos y a otros, una de dos: o no tener el corazón limpio o creerse cualquier cosa.


Saludo bweno desde choza mía. Que felicidad inundar choza vuestra.



Burundanga.

133 Rojo4, día

Al menos la defensa no está mal.

Maldita realización que nos quitan el tiempo muerto de Messina.

Y qué bien es eso de ver la cara de alguien mientras el balón vuela hacia canasta, sí señor. Es como ver la cara de los mecánicos cuando se acaba de ver al coche de atrás salirse del rebufo.

P.D. - Bryson zanguango y zimuérzago :P.

134 Rojo4, día

¡Uyyyy! Prigioni se ha jugado una antideportiva.

Él no se merece esos términos de zanguango o zimuérzago, no señor. Nada que recuerde a Bryson para él.

135 Tudemial, día

Muy buenas noches.
Frjparen (5) HeiaSafa(18)

Me alegra de que os haya gustado. Muchas gracias.

En la Europa League, una de cal y otra de arena como aquel que dice.
Enhorabuena a todos los atléticos. Habeis conseguido la clasificación por los pelos pero que diablos, estáis en la siguiente ronda.
Amigo Melkkiad hoy el athletic ha hecho un partido para olvidar. Bueno, muchos ánimos y espero que el año que viene juguéis de nuevo por esos campos de europa.

Un saludo a todos.

136 Rojo4, día

El RM tiene que aprender a defender la línea de fondo, es un coladero.

137 Islote, día

Que falta de respeto a los lectores de este honorable medio. Vergonzoso

138 Capaldi, día


CORTESÍAS

-El Pipa también es muy grande fuera del campo. Gracias por los enlaces.

-Impresionante salida de wsmith a las 14:22. Lo más madridista que he leído en mucho tiempo. Y ”Los duelistas”, sí señor. Cada año me escucho un fado y me veo Los Duelistas de Scott. Ole.

-Estamos esperando otro soneto, Tudemial.

-Ostane on air! Que te den un programa, collons, ni que sea de jardinería japo. ¿Has estado alguna vez en el Bar Chaplin de Cerdanyola? Una vez entré allí a ver un Madrid-Barsa (el del gol de Owen) y me sentí como si estuviera dentro de un botafumeiro.

-Percival: Faith es lo mejor de The Cure” con diferencia; por el contrario, Celda211 me pareció muy previsible, muy floja; y Rooney no es, se ponga como se ponga, el jugador más sobrevalorado del planeta. ¡Retráctese!

-Brysonato! Molta feliccitá pero la recuperazione. E Molta inquina in contra di Il Loco di Catania de tua parte, e io no concuerdi totalmenti, fratelo mío. Forza.

-Azulone, grache mile un altra volta.


Sin tiempo pa ná. El Masai lo chupó tó el muy mamón. Tapronto, família.

139 wsmith, día

Sato 17 puntos.

En todos los partidos de la segunda fase nos ha tocado un jugador haciendo el partido de su vida. Le han perdonado una técnica que era la 3ª falta.

Tomic mejor que en los partidos anteriores. Por lo menos ha enseñado alguna cosita más en ataque. Su primera canasta ha sido buenísima. En defensa intimida por la altura, aunque en el choque le falta cuerpo.

Menudo partido horrible de Bullock.

140 Rojo4, día

Hay una regla que no se está respetando, y es la de que en los saques debe haber una distancia mínima de un metro. Se ha visto, por ejemplo, a Llull dando la pelota en la mano a Prigioni delante de los árbitros sin que dijeran nada. En esa en concreto podría entenderse porque el rival más cercano estaba en el otro campo, pero ha pasado otra vez entre otros jugadores unas jugadas más adelante en que el Montepaschi estaba ejerciendo una mediana presión.

141 Bryson, día

"Caro Fiorentinno!! Éétttore al telefonino.

Nezzesitto algunos jugattore para la segunnda parte. Tome notta. Hierbaskas, Esguinzovic, y a Capalddi, grande Masai, fuorte e grande, bueno en rebotte.

E si no, io non sonno responsabile.

E reccuerde. El malo e Pellegrinni."

142 percival, día

¿Pero no me retracté ya?

La temporada del bulldog le calla la boca a cualquiera, Capaldi. Y bueno, sólo un lerdo muy lerdo está incapacitado para rectificar ante la evidencia de los hechos.

Aparte de Disintegration, que juega fuera de concurso, mi Cure favorito es Pornography (con perdón).

Top 5 furgolistas ingleses:
1.- Chris Waddle
2.- Gazza
3.- Gary Lineker
4.- El Macca del 96.
5.- Steven Gerrard.

(Los cuatro primeros jugaron juntos).

143 cule1899, día

Qué partido más raro en Grecia.

Se va el Panathinaikos 19-5 (con 12 puntos de Petkovic), con pájara brutal del Barça.

Y de ahí se pasa al 26-33, un parcial de 7-28 ... alucinante.

Je, y de ahí al 37-33 del descanso, 11-0.

A ver si la segunda parte es más normal ...

144 Rojo4, día

¿Notando la derrota de Copa?. No, mostrando lo mismo que en la copa: la debilidad mental de una gran parte de la plantilla.

Esa final fue motivo para pedir destituciones, pero no del entrenador, sino de jugadores.

145 Bryson, día

Twitter

21.41 Bryson, malíssimo

21.49 Rosso4 buono

21.50 Ricordare enviar cheque de 1000 euros a Rosso 4.

21.52 Espagnolos, bobos e catettos.

21.53 Tocomocho, jeje.

146 Rojo4, día

Si no es decapitación, no es falta.

147 wsmith, día

Los árbitros se van de vacaciones, nos cascan 3 triples seguidos y otra vez 8 abajo.

La cosa empieza a pintar mal, porque de lejos no metemos una y Lavrinovic no encesta ni una pelota de golf.

148 cule1899, día

Coñe, en el partido del Madrid, hay un tío repetido ... ¿Eso es legal? :)

149 cocoom, día

Impresionante el comentarista de TDP.

Dijo que el KK Zagreb había ganado la Copa del Rey de su país.

La República de Croacia es un reino muuuuy antiguo, como todo el mundo "save".

...

150 Rojo4, día

A Alzola tendrían que decirle que con diez segundos de posesión aún no es necesario tirarse pedradas.

151 Rojo4, día

Vaya un "palmeo"

152 zvi, día

Propongo a Bryson como nuevo entrenador del júrbols de tios altos, el sabe de eso más que nadie en este país, lo ganó todo en categorías inferiores hasta que una desgraciada lesión inguinal te apartó del deporte. Además, así podré conocer a Adriana Lima.
Bryson, tú puedes!!
Hay algún cumpleaños hoy, bro?

153 wsmith, día

Espectacular:

El Zágreb ha ganado la Copa del Rey de su país

Ay Tomic, la que has fallado que nos ponía a 4... Buena última jugada del Madrid y Llull empieza a hacerse notar.

Bueno, 5 abajo y 10 minutos de partido.

154 cocoom, día

Rojo4

Ese lo palmea más fuerte mi crío de 7 años.

Deberá ocurrir un milagro para ganar el partido. No te digo nada ya ganar por más de 8.

Una quimera.

155 Rojo4, día

Jope, el árbitro ha tenido que pensarse ese campo atrás.

156 wsmith, día

Rojo4

o que Llull empiece a tirar del equipo. Esto tiene otra pinta.

Por cierto, que alguien le diga al de TDP que TMac es Tracy McGrady, no McIntyre.

157 Jenophon, día

Vaya tela de partido.

Los únicos que tienen carácter son Reyes y Llul.

Y vaya panda de prejubilaos que se ha traido el Messina aprecio de oro.

158 cocoom, día

wsmith

Alguna otra cosita más básica habría que decirle

159 cocoom, día

Parcial de 12-2

Venga, vaaaamosssss

160 Jenophon, día

A precio...

Los de siempre tirando del carro, vengaaaaaa...

161 wsmith, día

cocoom

Hombre, de geografía ya hemos visto que va sobrao...

Necesitamos 5 Llulls en la plantilla.

Cómo ha cambiado el partido. A ver si ahora no la cagamos.

162 Rojo4, día

Y que lo digas, Jenophon, Reyes, Llull y Jaric son los únicos con pelotas. Hoy Jaric se está c@g@ando porque lo está haciendo literalmente (está con gastroenteritis).

Tomic, ese sexagenario :P (no es más que una broma, sí que estoy de acuerdo en que hay más treintañeros de los que sería de desear).

163 cocoom, día

Unos saltos Masai serían bien recibidos

Vamos zanguangónidos

164 Jenophon, día

Vaya personal en ataque que han pitado a Tomic los ca...de los arbitros...

165 wsmith, día

Llull Llull Llull

166 cocoom, día

El esloveno nos está masacrando...

Ahora, Tomic tiene menos sangre que un saltamontes.

Joer, hay que destrozar el aro para intimidar, no dejar ese bandejita... mingafría

167 Rojo4, día

¿El italiano está pensando en la diferencia de puntos?.

168 wsmith, día

Grande Prigioni ahora.

169 Jenophon, día

Vamoooooos, oleeeeee, defensaaaaaa....

Esto si es mi Madriii, gane o pierda...

170 Azulon, día

Cule (99). Tu factura. Me ha llegado. Verifica que es esta.

http://2.bp.blogspot.com/_XcbA9g0Ppvc/S1hvujyFfYI/...

¿Es cierto que duermes de canto para no gastar las sábanas?

171 Rojo4, día

Jejeje, ahí ha estado bien, Prigioni.

172 Pablo1, día

¿Teneis por ahí el link de la intervención del gran Ostane con aquí el blogger? Se agradece.

173 wsmith, día

Tomic tiene buenos movimientos. Con 2 años más será un buen jugador.

174 cocoom, día

Pablo1

http://www.cope.es/la-tarde-con-cristina

Vete a la pestaña audios.

Busca el lunes 22 de Febrero

El de Deportes

http://www.cope.es/la-tarde-con-cristina#top

175 Rojo4, día

Bien, Messina tiempo muerto, maldia sea que no lo han dado antes del tiro.

176 cocoom, día

Vaya triple en suspensión

QUE MUELLES

LLULL LLULL LLULL

177 wsmith, día

Lluuuuuuuuuuuuuuuuuuuull!!!!!!!!!

178 Jenophon, día

Oleeee,LLUL LLUL LLUL LLUL LLUUULLLLLL

Graandeeeeee

179 Rojo4, día

¡GUUUUUAAAAAAAAAAUUUUUU! Y han pitado falta, ¿no?. ¡¡3+1!! Jajajajaja. ¡Qué bueno!.

Ah, qué pena que no lo haya metido. Bueno.


coccoom, al final del tercer cuarto te iba a decir que yo no lo veía tan mal, a pesar de esos detalles de desmoralización que se vio por ejemplo a Kaukenas renunciando a ese tiro fácil de dos tiros; pero pensé que mejor callarse, que ya vemos lo que valen las predicciones expresadas en este blog.

Dos cosas fundamentales para el final:

- El tal vez menos relevante, que ha sido el entrenador de los italianos pensando en diferencia de puntos, que era como decir a los jugadores que el partido estaba perdido: mazazo para su moral.

- Segundo: Ante Tomic ha mostrado su inexperiencia y blandenguería (a pesar de lo cual por números estaba el más valorado a tres minutos para el final), pero también ha mostrado algunas de las cosas por las que Messina se ha fijado en él como un futuro buen jugador. Pero sobre todo, lo más importante han sido sus centímetros, que ha movido bien en defensa para estar delante de bastantes tiros que han intimidado más que evidentemente al rival y ha permitido ganar tantas posesiones y tantos contraataques.

180 Aliocha, día

Emocionantísimo final de partido.

Qué grande Sergio Llul, y muy bien Tomic.

181 cocoom, día

Ufff, ha sido un final orgásmico

Y estos gili.pollas no repitieron el triple final, fue espectacular.

Bueno, se me había olvidado dar la enhorabuena a los colchoneros.

Lo siento por melkkiad y el ATB.

El Villarreal palma 4-1 en Alemania. Mala pinta tiene este equipo.

El Valencia sólo gana 1-0, pero está cerca del segundo. Vamos Torino, leñe, anima.

Rijkaard rajando de los árbitros... para no perder la costumbre.

Dicen en tele5, que al finalizar el partido del Valencia, darán en diferido el Galatasaray-ATM en el canal de TDT La Siete.

Ah, que se me olvidaba.:

El pésame para las familias del socio nº1 del Real Madrid y del expreparador físico del Real Madrid de Baloncesto.

182 Aliocha, día

Rojo4

Me da que el tiro libre lo ha tirado a fallar para que se consumieran los segundos finales.

183 Pedrinho, día

Qué grande Llull.

Qué grande Forlán.

Y qué grande el árbitro del partido del Atleti. Cocoom, esta vez Rijkaard tenía motivos para quejarse. El penalti de Perea ha sido tremendo.

184 Rojo4, día

La realización ha sido de pena, poniéndonos la cara de los entrenadores en mitad de jugadas, siguiendo el primer plano de la cara de un jugador sin balón, poniendo repeticiones con el ataque en plena marcha o enfocando de nuevo la cara del entrenador con el balón en el aire hacia la canasta.

Vaya trío de árbitros malos.

De nuevo Llull ha estado genial, pero Tomic ha sido la gran clave de la victoria.

185 cocoom, día

Rojo4, Aliocha

Es cierto que bien Tomic en el último cuarto, pero pelín blandengue. Hizo dos buenos movimientos en ataque en momentos muy importantes. Hay que meterle kilos y inyectarle "sangre". Un center es un center, coño.

Bueno, se alcanzó la quimera.

Me alegro sobremanera.

Ah y un detalle, Valdano hoy también mandaba mensajitos por el móvil. Bueno, en realidad correos, que era una BlackBerry :PPPP ¿Se está poniendo de moda?

186 Jenophon, día

Sí, lo ha tirado a fallar. Se ha visto como Mesina mandaba cubrir el rebote, para entorpecer la salida de los italianos, y consumir el segundo y ocho décimas que faltaba.

187 Rojo4, día

cocoom, eso no tiene discusión. Que le pongan con el sargento de Chaqueta Metálica.

Sí, tiene mucho sentido, cuando escribí creía que la derrota de Siena fue por ocho, no por siete.

188 chu4che, día

muy bien el atleti,por lo menos tenemos a uno en octavos.
a ver si el valencia pasa también.

no he visto lo de LLull,a ver si lo encuentro,es un crack

189 cpsvcp, día


Bryson, se agradecería que comentaras el partido de basket de hoy del Madrid...

190 cocoom, día

chu4che

Cuando lo veas te vasa a caer de culo, fijo.

Rojo4

Sino mejor que le digan que puede hacerle una visita Jack Bauer...

Vamos Valencia, leñe. Han fallado la de Dios. Huele a prórroga. Vamos, leñe

191 cule1899, día

Panathinaikos 67 Barcelona 70

Por fin hemos ganado un final ajustado. Era nuestra tarea pendiente.

192 cocoom, día

Pues venga, que estamos generosos.

Felicidades también

cpsvcp

Bryson seguro que se ha atragantado con algún spaguetti :PPPP

193 Jenophon, día

La remontada se ha fraguado alrededor del trio, Reyes, LLul, y Tomic, con la aportación puntual del oficio de Prigioni.

Buenos movimientos de Tomic, muy bien en el rebote junto a Reyes, sobre todo en el de ataque.
Por fin ha demostrado que puede aportar a este equipo, y que no es un jugador LEB.

Y sobre todo, sobre todo, Llul y Reyes a base de casta han metido al equipo en el partido, demostrando a alguno de los prejubiladetes que hace falta intensidad si quieres funcionar en la primera linea europea.

De hecho el equipo se ha mantenido vivo gracias a los puntos dentro de la zona y a su dominio del rebote, porque el día de los exteriores, excepto LLull ha sido nefasto, con unos porcentajes pésimos de tiro de 3, y un montón de perdidas.

Veremos si animícamente le sirve al equipo esta victoria para centrarse un poquito, incluyendo a Messina, que creo que es el primero que tiene muchas dudas sobre las posibilidades de su propio equipo.

194 cpsvcp, día


Necesito un "chute" de esos de Bryson de apelativos cariñosos a nuestro entrañable ETTORE...

¿Qué se hizo de esas críticas aceradas a MESSINA?

¿Qué se hizo del "Ettore vete ya"?

¿Cuántos equipos, incluido el Barça, están en condiciones de ganar al Siena por ocho puntos?

La realidad se impone: MESSINA es un entrenador de primer nivel (con sus aciertos y errores), pero el maldito CHILENO, NO.

Por cierto, el arranque de casta del último cuarto al dar la vuelta al partido es netamente espíritu madridista. Lástima que de momento tengamos poco de eso esta temporada en el fútbol...

195 Rojo4, día

Esperemos que este partido, una vez que se re-empezó la mejora táctica, suponga el comienzo de una mejora anímica de los jugadores, aunque eso sería bastante más difícil, creo yo.

196 Jenophon, día

Hombre, tampoco se puede decir que lo de hoy sea para echar las campanas al vuelo...

Lo más criticable en Messina, no es su manejo de los partidos, ni su sabiduría táctica, que nadie la pone en duda. Lo mas criticable en mi opinión, es la confección de la plantilla, donde el ha hecho y desecho con Maceiras como le ha venido en gana.

De hecho ya hubiesen querido otros entrenadores anteriores del Madrid disponer de ese dinero y sobre todo de esa libertad, para mover la plantilla a su antojo.

Y rodeárse de una guardia de corps, de jugadores muy conocidos por él, pero ya cargaditos en años, y cuyo rendimiento es mas que dudoso, es donde creo que está su principal error, que probablemente paguemos caro esta temporada.

Amén de otras "omisiones" como la falta de un 3 de garantías, o un center defensivo que creo que a este equipo le hace falta como al comer.

Además como tu comentas, hoy se ha ganado el partido por un arranque de casta, mas que por otra cosa. Aunque hay que reconocer a Messina que ha tenido la inteligencia de mantener en cancha el ultimo cuarto a los jugadores que estaban enchufados, y no ponerse a hacer rotaciones en los momentos calientes.

197 Rojo4, día

Me quitas palabras de la boca, Jenophon, estaba esperando a los dos minutos para decir lo que se me olvidó: se ha ganado, con un último cuarto espectacular tras un buen final del tercero, pero eso ha sido precedido por medio tercer y primer cuartos más un segundo que han sido pobres en rendimiento, con algunos de esos jugadores mostrando blandenguería.

Que se ha dado un salto adelante es cierto; pero aún queda mejoría que recorrer hasta el nivel requerido para poder empezar a jalear con entusiasmo al equipo.

Sí hemos visto que el equipo merece tener confianza, aunque haya estado hace poco cerca de perder todo merecimiento a ella (y hablo del partido de ida ante Siena), porque muestra que puede ir arriba.

198 PATETRIC, día

Rojo 4, no se si has tenido la ocasion de ver el partido del Barsa pero las rotaciones de Xavi Pasqual casi nos cuestan el partido.

Basile no juega lo que deberia, y Navarro, que al final ha estado bien ha estado horroroso durante casi todo el partido.

Cuando estaban lakovic, grimau y basile las enchufabamos todas, y va el tio y los cambia cuando nos ponemos delante.

Ngong a mi me parece una patata.

Este Barsa en Espana se pasea pero en Europa le pillan unas pajaras de cuidado, y no me gusta su manera de plantear los partidos.

Ale

199 Rojo4, día

No he podido verlo, PATETRIC, así que no puedo comentar sobre ese partido.

200 Jenophon, día

Acabo de ver las estadisticas del partido en la pagina de la Euroleague, y son bastante clarificadoras.

Solo en un cuarto nos han hecho los italianos más de 20 puntos, el segundo (16-21-16-16). El porcentaje de sus tiros de 2, muy bajo, 12 de 26 (46,1%), mejor defensa dentro de la zona. Sin embargo su 38,4% de tiros de 3 (10 de 26), y el hecho de que hayan tirado las mismas veces de 3 que de 2, habla mal de la defensa del Madrid de hoy en el perímetro. Y eso que McIntyre hoy se ha tirado de 3 hasta los gayumbos con una serie infame (3 de 12).

Dominio en el rebote del Madrid (35 vs 27) de los cuales ¡12! en ataque...4 de ellos de Tomic.

Porcentajes en ataque medianitos, 50% en tiros de 2 (18 de 36) y un 33,3% en tiros de 3 (7 de 21) arreglado al final gracias a Llul (4 de 6), porque hoy el resto de los exteriores, Hansen (1 de 3), Prigioni (1 de 4), Kaukenas (1 de 5), Bullock (0 de 1), y el interior-exterior Jorge alias " insersoman" (0 de 3), han estado "pa haberse matao".

Jaric no cuenta porque estaba con gastroenteritis el hombre, aparte de que con una señora como la que gasta, yo le perdono todooo...



201 cpsvcp, día


Jonephon, Rojo4 y Patetric: Da gusto leer vuestros comentarios, creo que sabéis de los que habláis. Enhorabuena, enriquecéis el blog.

202 Aliocha, día

cps

Siento decirte que tus comentarios hacia Bryson pecan de oportunistas. Si hubiera perdido el partido el Madrid habría estado virtualmente eliminado de la Euroliga, es decir, hoy se ha cumplido y punto, no es para sacar pecho.

Ni Messina era tan malo el domingo ni hoy es tan bueno.

Y lo del "maldito chileno" sobra.

203 Jenophon, día

Huy, error, donde pongo Kaukenas (1 de 5), debia ser (0 de 1). La serie de 1 de 5 es cierta pero son de tiros de 2.

Por cierto, Tomic aparte de los 4 rebotes en ataque, ha cogido 5 mas en defensa para sumar 9, mas una buena serie de 2 (5 de 8) y ¡3 asistencias! Muy buenos números, enhorabuena para el chaval.

204 Osiris, día

Y el Panathinaikos eliminado.

205 Pablo1, día

Cocoom, mil gracias, ya lo he escuchado.

Ostane: eres un crack, compañero...

206 cpsvcp, día


Aliocha: efectivamente, puede ser oportunista, pero repasa los calificativos de Bryson hacia Messina del otro día, simplemente por haber perdido una ¡¡final de Copa!! frente al Barça, y tendrás que reconocer que lo de "maldito" suena muy muy suave en comparación.

Ahora justifico lo de "maldito":

1. Los responsables directos de haber sentado ahí al maldito chileno son Florentino y Valdano, y no sé en qué orden. No es la primera vez que se equivocan en la elección del técnico, o en la destitución de quien no debían (Del Bosque), y por ello les critico en primer lugar.

2. Soy socio del Madrid desde hace 40 años, y sé algo de fútbol. Como decía Juanma, no vale con ser educado y poner cara de póquer o de cemento, para ser un entrenador adecuado para el Madrid.

3. Pellegrini en mi opinión lleva toda la temporada dando bandazos en lo táctico, desperdiciando el enorme talento que han puesto en sus poco hábiles manos, y desaprovechando una oportunidad histórica para construir de verdad un equipo que pueda iniciar un ciclo histórico. Por eso lo de maldito.

4. Ha habido muy pocos buenos partidos con rivales de nivel (quizá el del Valencia; el del Depor fue una buena victoria, pero el Depor ahora es un equipo flojo), se han perdido los partidos más importantes de la temporada (Barça, Sevilla, Milán, Alcorcón, y sobre todo Lyon), el equipo es incapaz de remontar, y salvo las genialidades cada vez más abundantes de Cristiano, es un equipo que no controla los partidos y aburre. De ahí lo de maldito.

5. El maldito chileno está gestionando muy mal a alguna de sus figuras, en concreto Kaká y Benzema, y ha demostrado una torpeza sin límites marginando a Guti y a Granero un par de meses desde el alcorconazo.

6. Hay unos cuantos argumentos más para lo de "maldito", pero no quiero aburrir...

207 Osiris, día

Se te olvida lo de Marcelo.

208 Rojo4, día

PATETRIC: no he visto suficientes partidos del Barça para tener un juicio definido de Ndong, perosí es cierto que tengo la sensación de que pueda ser el más flojo del Barça. Contra el Cajasol cometió una técnica injustificada después de una falta innecesaria; no tengo sus estadísticas a mano, pero no creo que haya aportado tanto en los partidos que le he visto. Acabo de verlo y sí, aporta bastante poco, sus medias son muy bajas (claro, que con todo lo que hay en el equipo...). Aunque en defensa da más solidez que Morris, de hecho en la Copa del Rey se vio que uno de los filones del rival fue atacar a Morris. Sin embargo, Morris tiene mucha mejor muñeca, tanta movilidad, más inteligencia en su juego... me parece mucho mejor.

Por cierto, en acb.com, no figura Lubos Barton en la plantilla, tampoco aparece como baja, ¿le han dado de baja?, ¿no se ha recuperado de la lesión?. Iba a decir que cuando se recuperara yo me plantearía que Ndong fuera la baja.

209 Osiris, día

Qué grande Higuaín, y llevo un minuto de entrevista. Ya le ha marcado una par de golitos al Pedrerol.

210 cpsvcp, día


Osiris: Tienes razón, se me olvida lo de Marcelo, lo de Xabi Alonso jugando en la cueva, cuando siempre ha sido un jugador con llegada y con gol, y aquí ha tenido que mendigar un penalty en el que él no pintaba nada, lo de los cambios absurdos, lo de sacar a Raúl en una posición de no se sabe qué, lo de Mamadú en Lyon cuando había jugado partido y medio, lo de las declaraciones impropias de un entrenador del equipo: "no es una final" antes del partido contra el Depor, lo de Arbeloa a la izquierda cuando rinde 3 veces más a la derecha...

211 cpsvcp, día

Sigo con mi amigo el chileno: lo de no armar jugadas de estrategia, combinaciones, posiciones en el campo, jugadas de presión, desmarques, etc. para aprovechar debidamente el "arma letal" que es Cristiano...

Me produce úlcera gástrica el maldito chileno

212 Osiris, día

La evolución de Gonzalito ha sido evidente. El pelo más cortito le va mucho mejor.

213 Aliocha, día

cps

Contra tus opiniones (y prejuicios) te dejo este dato: hasta el momento el equipo de Pellegrini ha obtenido las mejores estadísticas del Madrid en Liga de los últimos 15-20 años.

214 morlako, día

Bueno, pues nos toca el Sporting Clube de Portugal. Uno de los tres grandes del fútbol portugués, donde sí que son tres, con todas las de la ley (de hecho, el menos grande es el Porto, pero en cuanto a aficionados, porque en títulos lleva 25 años dando un repaso bestial a los otros...). Un muy buen equipo, con buenos jugadores (entre ellos el excelente Sinama Pongolle, jeje). Deberíamos pasar nosotros.

En la UEFA quedan unas cuantas eliminatorias majas: Werder Bremen-Valencia promete, o Benfica-OM.

Favoritos para pasar de ronda:
Valencia
Juve
Liverpool
Hamburgo
ATM
Panathinaikos
OM/Benfica
Rubin Kazan (sí, me parecen mejores que el Wolfsburgo).

Quedarían unos cuartos bastantes majos.

215 Aliocha, día

cps

Te contradices tú mismo, si reclamas a Arbeloa por la derecha ya me dirás a quién ponemos de lateral zurdo.

216 cpsvcp, día


Aliocha: Siento que pienses que son prejuicios, pero mis opiniones las argumento, ¿cuáles son los tuyos?

En cuanto a las estadísticas, el Madrid de JUANDE batió el record de victorias, y ningún madridista estaba contento, el equipo jugaba de pena (era peor equipo que el de ahora), daba una sensación horrorosa, y todo acabó con el tremendo mazazo y ridículo del 2-6. ¿De qué sirvieron las estadísticas entonces? ¿De qué van a servir ahora si caemos en octavos o en cuartos?

Para mí todo lo que no sea disputar la Liga hasta el final, y llegar a nuestra final de Champions en el Bernabéu es un fracaso. Equipo y jugadores hay para conseguirlo. Que el entrenador sepa sacarles partido es otra cuestión...

217 Torino, día

Vaya sufrimiento de partido..se les pudo ganar en Brujas y palmamos..hoy se han librado de la goleada y casi nos marcan quedando 10 minutos.Pero bueno...bien esta lo que bien acaba.
Se agradecen los animos.

218 flintoff, día

Morlako, hombre de poca fe, si ya verás, el Atleti hace doblete este año (y aprovechando esto, los giles venderan el club, bueno esto último no lo creo).
Al que se le pone muy bien es al Valencia, tercero en la liga, el segnundo imposile de alcanzar y por abajo tiene colchón con el quinto, así podra descansar a gente en la liga.

219 cpsvcp, día


Lo de Arbeloa ya lo he explicado.

Había un entrenador muy hábil muy hábil que como tenía un problema con el lateral izquierdo, resolvió colocar ahí a un muy buen lateral derecho, pero mejor que la calamidad de Marcelo en esa banda, estropeando de paso a un excelente central (Ramos) para así desequilibrar tres posiciones en lugar de una.

Lo de Arbeloa a la izquierda tiene que ser una solución de emergencia, no el esquema habitual.

Se me ocurren varias soluciones, y no me pagan el sueldo de Pellegrini, para ello:

1. Pedir un lateral izquierdo en el mercado de invierno, ya cerrado. El maldito chileno no lo ha hecho. Es evidente que tenemos un agujero en esa posición.

2. Subir y foguear a un chico de la cantera, como hace Guardiola con los suyos. Alguno habrá con talento. No siempre acertará, pero mejor que Marcelo...

3. Buscar otro jugador de la plantilla que pueda adaptarse a ese puesto. No se me ocurre ninguno, pero el entrenador es él.

220 Aliocha, día

El Madrid de Juande batió el record de victorias, sí, pero yo no me refiero sólamente a las victorias sino a puntos conseguidos, goles marcados y goles encajados.

Mi único argumento es que hacía muchos años que no veía a un Madrid tan ofensivo, tan sólido y tan bien posicionado como el de esta temporada.

Coincido contigo en que las estadísticas de poco valen si finalmente no se logran títulos pero coincidirás conmigo en que en febrero es difícil haber conseguido algún campeonato.

221 PATETRIC, día

Rojo 4, Morris ha estado bien en el primer cuarto. Tiene muneca es cierto.

Ngong coloca tapones pero falla lo indecible en ataque y es muy torpon. Vazquez le da mil vueltas pero no juega tantos minutos.

Y luego Lakovic y Basile demuestran tener mas tablas en europa que navarro o riky, pero no les dan minutos.

A mi este tio no me gusta, es mas un problema q una solucion xq no sabe leer partidos, y cuando lleguen el cska o el macabbi pues ya veremos, pero mi impresion es que no le saca todo egl jugo q deberia a una plantilla tan larga

222 Aliocha, día

Que la plantilla esté descompensada y le falte un lateral zurdo de garantías es culpa sin duda del "maldito chileno".

223 Aliocha, día

Por otra parte, me asombra la doble vara de medir que utilizas para enjuiciar al "maldito chileno" Pellegrini y al "bendito italiano" Messina.

224 Osiris, día

No dejo de pensar en "ezos marditos roedores".

225 Aliocha, día

Y además Pellegrini es alto, elegante y resultón.

No se hable más.

226 Aliocha, día

Y puestos a probar, yo pondría a Dudek de lateral izquierdo.

227 chu4che, día

que mania con que Pellegrini es el que mató a Manolete.

si la plantilla es tan mala porque lleva los puntos que lleva y los goles que lleva????

es que se cae por su propio peso.

pellegrini dijo que contaba con Robben y Sneijder y aun asi los vendieron en vez de vender a Drenthe por ejemplo y encima la mala configuración de la plantilla es suya,tiene huevos.

228 cpsvcp, día


Me ha gustado el toque de humor de lo de DUDEK, pero quizá sería mejor poner a SARA CARBONERO...

Pellegrini no tiene la culpa de lo del lateral izquierdo (ya he dicho que también Valdano y todos los "Buitres" que le rodean tienen su cuota de culpa), pero su obligación es la de buscar una mejor solución que la de poner al nefasto Marcelo, o la de volver loco a Arbeloa, que ya no sabe qué pierna tiene que utilizar...

Es verdad que Pellegrini es alto, elegante y resultón, pero Queiroz era todavía mas pinturero, y fíjate qué resultado...

Te concedo que en febrero pocos títulos se pueden haber ganado, pero nos han eliminado de la Copa (una constante), y lo de Lyon veremos cómo acaba...

Por eso no tengo más remedio que juzgar lo que veo todos los domingos, y se reduce a un inmenso, genial, inconmensurable CRISTIANO, y poco más.

En cuanto a MESSINA, no me parece fantástico, simplemente me parecían injustas las críticas de Bryson.

229 cpsvcp, día

Chu4che: Pellegrini (al parecer) no ha influido mucho en la plantilla que tiene, pero su obligación es sacar el mejor partido de lo que tiene (que no es poco), y en mi opinión está muy muy lejos de conseguirlo.

Tampoco Pellegrini es responsable de tener al mejor jugador del mundo en su equipo, y sin embargo se favorece de ello, pero es incapaz de aprovechar más a su favor al inmenso CR9

230 Dedalus, día

Muy bien, cpsvcp, ¿y a quién propones como mejor entrenador? Escucho sugerencias.

Después de oír que para ti era mejor RC que Arbeloa en el lateral izquierdo, estoy sumamente interesado en tus teorías. Prometen originalidad.

Sé que me paso de pesado para llegar a quintálico, pero el RM necesita un mediocampo FUERTE para jugar de visitante. Si nos van a poner el pedazo de césped que vimos en Lyon el otro día, mejor meter poderío físico porque de tocar, nada de nada. Y lo tenemos:

MADRID VISITANTE:
Casillas
Ramos Albiol Garay Arbeloa
Lass Mahamadou
Alonso
Cristiano Benzema Higuaín

MADRID LOCAL:
Casillas
Ramos Albiol Garay Arbeloa
Lass Alonso
Kaká
Cristiano Benzema Higuaín

231 taillon, día

Buenas noches.

Dedalus, mucha fe tiene tu en Benzema.
De acuerdo con reforzar el campo en campos dificiles, pero con ese medio campo chungo para crear....

232 cpsvcp, día


Dedalus: Reclamo el mismo respeto que te tengo a tí, a tus opiniones y a tus equipos propuestos.

233 Dedalus, día

Hombre blanco Dedalus agradecer grande a sabio Masai. Hombre blanco prometer respuesta a la altura de cuerno de rinoceronte, enhiesto, orgulloso, prometer por nariz de Messi e Ibrahimovic juntas.

Hombre blanco cavernario decir que masai ser muy grande, y que saltar hace más grande, y que ser orgullo gritar ¡HUNGA, HUNGA! con gran masai.

Hombre blanco abrazar fuerte, fuerte a hermano Masai.

234 taillon, día

Por cierto, como joden las verdades...

http://www.libertaddigital.com/sociedad/malestar-e...

235 cpsvcp, día

Dedalus: Yo no dije que Roberto Carlos fuera mejor que Arbeloa, pero si dije y vuelvo a decir que haría mejor papel que Marcelo, aun viniendo viejo y cojo (por cierto se ofrecía gratis). Evidentemente no es la mejor solución para el equipo, pero aportaría mucho más que Marcelo, y estaría motivado en su "cuarta juventud".

Entrenadores que propongo, en este orden:

1. Del Bosque, simultaneando selección y Madrid - Otras veces se ha hecho.

2. Benítez, un gran estratega capaz de hacer campeón a un Liverpool limitadito, y de hacer crecer a jugadores como Torres, Xabi Alonso (tan distinto aquí gracias al maldito ingeniero), o el mismo Arbeloa.

3. Un gran ex-jugador que entienda la mentalidad del Madrid, intentando repetir la "jugada Guardiola". Ejemplos: Hugo Sánchez, Laudrup

4. Raúl González Blaco, jugador-entrenador. Acabaría su carrera con dignidad, sería un nuevo reto, y lo mejor, sería capaz de sentarse a sí mismo, demostrando madurez y señorío. Parece improbable, ¡¡pero podría salir bien!!

Espero haber sido original...

236 Dedalus, día

taillon:

Personalmente, la famosa creación está sobrevalorada. Cuanto antes empieces el ataque, mejor será. Y REPITO: Ni Lass ni Mahamadou son cojos. Con esos dos les metimos 6 al Zaragoza; y lo que es más importante, dominando imperialmente, y creando juego. Los negracos no son enemigos del buen juego; ésa es mi tesis.

cpsvcp: Te pido perdón si te he faltado al respeto. No era mi intención (A veces me paso, lo sé). Pero sí que me gustaría saber qué entrenador elegirías para nuestro equipo.

237 cpsvcp, día


Dedalus:

Tus equipos propuestos no están mal, pero Mamadú es un jugador limitado y acabado para el Madrid. Yo lo sustituiría por GUTI en el equipo local, y en el equipo visitante pondría a GUTI en lugar de LASS.

238 cocoom, día

Buenas noches.

Antes de nada felicitar al Valencia y, en especial a Torino. Bien. Buen partido que se debió resolver antes de la prórroga. A disfrutar.

Spartacus me tiene totalmente enganchado, lo siento taros, es lo que hay y por eso no me pasé antes.

Sobre N'Dong. Como ya dije es un desecho de tienta de la NBA. Con esa planta que tiene si sirviese para algo, con los pocos centers que hay hoy en día, estaría en cualquier franquicia.

Ello le inhabilita para estar en un grande, como el Barça. Además, no aporta ofensivamente y tácticamente es muy limitado.

Tomic será algo algún día, ojalá, pero de momento, poquito poquita. Es un alma de cántaro en el centro de la pintura. Una transfusión no le vendría mal.

No obstante, para andar por Europa, puede valer, donde se desprecia casi por completo el juego interior.

Llevar la línea a los 7m. podría ser una solución y seguro que volvían a parecer center europeos, como los de toda la vida, aunque en USA no parece que funcione, ya que el déficit en este puesto es grande. hay grandes center, pero se cuentan con los dedos de una mano.

cpsvcp

Fíjate que si le quitamos lo de "maldito", yo estoy de acuerdo en lineas generales con lo que expones. Pellegrini no es santo de mi devoción, pero, lo mismo que se pide para un entrenador como Messina, se debería de pedir para el chileno y más a estas alturas de año.

Lo de la Carbonero fue una boutade, como fácilmente habrás entendido, pero, según comentan los que siguen algo la cantera, en ese puesto no hay nada que rascar. Te aseguro que Marcelo me da el mismo repelús que Gago, sobre todo de lateral.

Si hablamos de posibles sustitutos, no mientes la soga en casa del ahoracado. Benitez, no gracias. Mourinho, en el Inter está de maravilla. Wenger, al parvulario. El escocés, pues eso, a lo suyo. Ancelotti en el Chelsea y... VdB, a parte de que tiene curro, durmiendo hace muuuucho rato.

No se me ocurre nadie a bote pronto...

(sigue)

239 cpsvcp, día

Si me pides mi opción de entrenador, he puesto cuatro posibilidades, y en mi opinión la mejor (aunque no la más posible) es Del Bosque, seguido de Benítez.

No habría que descartar la opción Raúl, que conste...

240 Dedalus, día

Perdona, cpsvcp, no había leído el anterior...

Queda escrito.

Si no te importa, de todas tus opciones me quedo con las dos primeras. La tercera no me gusta (Más que nada porque los experimentos se hacen con gaseosa) y la cuarta creo que es improbable: demasiada caña desde los medios para alguien tan importante.

Mi favorito sigue siendo el "infumable" Capello. Y después, Roberto Mancini.

Pero no me disgusta Pellegrini.

241 cocoom, día

(viene del #238)

chu4che

Eso de lo del toro que mató Manolete me suena.

Aplíquese a Raúl.

Últimamente parezco un raulista de pro (el carné esta cerca ¿verdad Líder?) pero no veo porque no habría de serlo, es un jugador del Real Madrid y yo soy madridista. Cuando lo tenga que criticar lo haré y entonces sere ¿antiraulista?. Jo.der que lío, no me aclaro

Lo mismo para Pellegrini, no me gusta, pero como es el entrenador de mi equipo y como no me gusta eso de cambiar de caballo a mitad del río (casi nunca funciona) pues a tirar hasta Junio. No queda otra, mal que nos pese.

Bryson

Porca misèria.

A comer pizza todo el finde :PPPP

Nada de cociditos, ni esperar comiendo güevo, ni leches.

A la arena, sangre y honor...

Dedalus

Paisano, lo de las líneas horizontales para enmarcar. Otra cosa es que el mensaje llegue. Un abrazo.

Que descanséis tod@s

salu2

242 cpsvcp, día


OK, Dedalus, me alegra poder intercambiar opiniones contigo.

Mi equipo "ideal" con la plantilla que tenemos sería:

Casillas

Arbeloa-Ramos-Albiol-Roberto Carlos/Sara Carbonero (esto último es broma, ya sabéis)

Xabi Alonso-Guti-Kaká

Higuaín-Benzema-Cristiano

Nos falta un lateral izquierdo.

243 chu4che, día

que pellegrini no esta sacando al mejor cristiano?????

pero tu estas viendo la misma temporada que yo??
ronaldo lleva 18 goles,sin jugar dos meses,que más quieres???
en el ManU metió 43 hace dos años entre todas las competiciones,liga,champions(que la ganó) y las 2 copas.
si sigue así terminará la liga con 22 - 24 goles, y según lo que se haga en champions donde lleva 6,ponle que termina con 8-10.

estamos hablando de 30-34 goles sin jugar dos meses y dos veces expulsado.

de pellegrini puedes decir muchas cosas pero eso no.

244 cocoom, día

cpsvcp

Por desconocimiento: ¿Raúl tiene el título de entrenador?. No tengo ni la más absoluta idea. No vayas a pensar que es una chanza, es que no lo sé.

Mancini tampoco me disgusta, pero en el City no está haciendo nada del otro jueves y con el Inter se vió que no daba para Europa, y eso que tenía a --, el megacrack, que juega igual con los brazos que con las piernas.

¿Laudrup tal vez?.

No sé es difícil.

Además, con tu larga experiencia, ya sabes que últimamente el Real madrid es una trituradora de entrenadores.

Yo creo que Ancelotti se acojonó, directamente. igual que Wenger.

Esperemos que en unos meses esto sean discusiones vagas e intrascendentes. Ojalá.

Salu2

245 chu4che, día

cocoom

yo nunca he criticado a Raúl sobre temas extradeportivos,no tengo pruebas.
yo solo he dicho que ya no estaba para jugar de titular en el R.Madrid.
eso si,cuando sale quiero que marque porque sigue siendo jugador del R.Madrid que es mi equipo.

246 cocoom, día

chu4che

Si es así, estamos casi de acuerdo, entonces.

Yo no hubiera dicho algunas cosas, pero en un calentón, todos nos extralimitamos.

Da igual.

Ala Madrid, que es lo importante.

247 cpsvcp, día


Chu4che:

Me explico. Pellegrini no ha diseñado un equipo que juegue para Cristiano, como hizo en parte Benítez con Torres.

Cristiano es tan bueno que él solo se fabrica las ocasiones, provoca la falta, da el pase, y a veces remata él también. Es decir, es mérito totalmente suyo, pero no de la configuración del equipo.

Por ejemplo, Xabi Alonso si jugara más adelante podría aprovechar su preciso pase largo para habilitar a Cristiano frente al gol. ¿Cuántas veces ha sucedido esto esta temporada? Ninguna.

Si los laterales abrieran el campo (sólo Arbeloa lo hace en parte cuando juega por la derecha), abrirían espacios para Cristiano. ¿Cuántas veces ha sucedido esto esta temporada? Pocas.

Sabiendo lo letal que que es Cristiano en el lanzamiento de falta, yo diseñaría jugadas específicas para intentar diseñar jugadas que pudieran acabar en jugada de peligro o en falta en la frontal del área. ¿Cuántas veces ha sucedido esto esta temporada? Pocas, casi todas las genera el propio Cristiano.

¿Cuántas veces se encuentra Cristiano con tres contrarios delante? ¿Dónde están los jugadores que teóricamente quedarían más sueltos gracias a tener tres pendientes de Cristiano? ¿Dónde están los apoyos?

A eso y a más cosas me refiero...

Cristiano es un jugador que podría batir todos los records goleadores, si el equipo estuviera mucho más afinado tácticamente.

248 morlako, día

Ándale, "Cristiano y diez más".

Con esa fórmula han habido hasta campeones del mundo. "Maradona y diez más": campeones en el 86 y subcampeones en el 90.

¿Doblete? Vamos, vamos, que me hacéis sonrojar. Sí que reconforta un poco llegar a Marzo vivo en dos competiciones coperas, pero lo cortés no quita lo valiente: llevamos una temporada bastante mediocre.

249 flintoff, día

La temporada que llevais es la propia del equipo que teneis. Una plantilla desequilibrada (esa defensa..) que en las copas os ha bastado con tener un solo partido bueno en cada eliminatoria para llegar hasta donde estais.
Imagínate, el ATM ganándole al Liverpool de Torres la Europa League...

250 morlako, día

Sí, la defensa es un desastre. Y da muy poca sensación de seguridad. Los tres años de Aguirre no se superan tan fácilmente, amigo.

Menos mal que están el Kun y Forlán, cracks al nivel de los mejores del mundo.

Con el Liverpool tenemos cuentas pendientes. Aún me duele ese penalti de Pernía sobre Gerrard. Se hubiese conseguido ser primero de grupo, con lo que eso conlleva en octavos en la Champions.

En fin, especulaciones puras.

251 taros, día

La canasta de ayer de Llull me recuerda al gol del año pasado de Higuaín al Getafe. Desatan la alegria y la euforia propias de la victoria en el último segundo.
Pero tapan que no es más que un arranque de talento y azar en el último segundo de un partido para meter un triple de 8 metros cayendose o una arrancada desde el centro del campo y un zurdazo que se cuela por la escuadra y derotan a un rival mediocre que hasta ese momento nos estaba dejando fuera de la competición.
No ganamos el título el año pasado, y aun no hemos ganado este, ni siquiera hemos pasado a cuartos con lo de ayer. Y estamos jugando en el alambre. Eso también deberíamos pensarlo. Después de disfrutar lo de ayer.

Y sí, LLull, Llull, Llull!!!

252 cpsvcp, día


Taros: Tienes razón, pero esa última canasta de Llull es equivalente al gol-milagro de Iniesta contra el Chelsea, clave para que el Barça ganara la Champions y los famosos 6 títulos...

253 Bryson, día

Buenos días...

cpsvcp

No es que me escondiera anoche, no estuve conectado. Acabo de leerte.

No ví (ni pienso ver) al Madrizz de baloncesto. Bastante sofocón me llevé el domingo. Por mí como si se van a cortar caña a Cuba.

Y sí, detesto a Messina, es un castaña pilonga (para mí, porque le tengo manía).

También te reconozco que no tengo ni pugnetera idea de baloncesto (ni ganas de tenerla).

Así que... Tú ganas. Pero Messina es un fraude y un capullín de la pradera.

Tengo que ir al dentista, y a esta gente casi les tengo más manía que al italiano, por lo que... no esperes conversación conmigo esta mañana.

Un saludo

254 cpsvcp, día


Bryson, suerte en el dentista.

Tienes todo el derecho a llevarte sofocones porque perdamos una final contra nuestro máximo rival, pero imagínate el que me puedo llevar yo si gracias al maldito chileno nos eliminan en octavos...

255 hermanus, día

Buenos días.
Bryson,
Seguro que te irá bien en el dentista. Son gente preparada por lo que yo sé. Me sabe mal que les tengas tanta manía. Son los que en definitiva te van a ayudar a tener una dentición sana y equilibrada.

Dos líneas sobre estupidez emocional. Un resúmen de un artículo de opinión de Ramón SOlsona en la Vanguardia que suscribo totalmente :
-"Como se puede comprobar semana traas semana, la incontinencia emocional recorre transversalmente todos los niveles, desdde los palcos hasta las gradas, desde las altas esferas federativas hasta el césped, desde los medios de comunicación más poderosos hasta el último blog que se asoma por el ciberespacio. Debo esta reflexión a la bronca que persiguió al jovencísimo Canales durante el partido del sábado en el Nou camp. Parte del público, enceguecido de antemano, le abucheó desde el principio hasta el final. Le silbaba cada vez que tocaba lapelota como se suele hacer con los jugadores a quienes se imputa un agravio, verbigracia un leñero, un comediante, un provocador, un tramposo, un tránsfuga...etc. Qué delito había cometido Segiuo canales para merecer tal reprimenda al pisar por primera vez el Nou Camp ? Haber fichado por el Real Madrid. Se le condenó a odio eterno sólo por eso, aunque el infantilismo de las reacciones colectivas suele ser transparente, y la pita a Canales revelaba una rendida admiración. Pura envidia. Algunos culés se jactaron de que, gracias al acoso psicológico de la grada, la perla cántabra no dió una a derechas. Es un mal cálculo. Me sumo a lo que afirmó Sergi Pámies en esta misma página :" Canales nos odiará para siempre y, el primer día que tenga la oportunidad, se vengará de nosotros y nos marcará, si puede, varios goles por la escuadra ". Sigue...

256 chu4che, día

cps

creo que el Liverpool con Torres no ha ganado nada,pero si tu dices que un equipo debe de jugar para un jugador,allá tú.
eso lo puede hacer un equipo pequeño o más defensivo,no uno grande. Nunca he visto a un equipo de los llamados grandes jugando para un jugador,como mucho la Francia campeona del mundo y de europa que jugaba al son que marcaba Zidane,pero no creo que hicieran jugadas específicas para que zidane tirase las faltas.

tú sigue dando estopa a Pellegrini por el color de sus calcetines.

257 hermanus, día

..." Hoy lo que priva es la cultura del abucheo, el automatismo del rugido primario que va directamente de las tripas a la garganta. Me siento en las antípodas de José MAría Aznar, pero entiendo su mal gesto. Me pongo en la piel de alguien abucheado constantemente, incluso donde debería imperar el sosiego, y no estoy seguro de que alguna vez yo no perdería los papeles. Se imaginan que Canales les hubiera hecho lo mismo que Aznar ?? Por suerte, tuvo la suficiente madurez emocional para no responder a la estupidez emocional ajena ".

TOTALMENTE DE ACUERDO. Ya manifesté la misma noche, que yo no había acudido al Nou Camp pero que no me entraba en la mollera eso de los abucheos al chaval del Ràcing.

Sobre el hilo de ayer :
Schuster será todo lo raro que queramos ( ya dio suficientes muestras de ello cuando era jugador ), pero seguro que no es un mentiroso ni tonto. Por tanto, yo le creo...pero no pasa nada por ello.

Agradable la comida del miércoles con cule1899 y ropalo. Sólo hablamos del blog y de deportes. Nada comoeso para desconectar de los problemas cotidianos...

Feliz viernes ( el mejor día de la semana ) !!

258 wsmith, día

Buenos días a todos,

ayer Messina se la jugó con Tomic y le salió bien. Ante el desastroso partido de Lavrinovic, se la jugó con Reyes y Tomic juntos y el croata respondió a las mil maravillas.

Ya dije al final del 2º cuarto que al chaval se le veía mejor que en los partidos anteriores, pero ayer se cascó una gran segunda parte. Esta claro que le falta muchísima experiencia y sobretodo eso que Luik llamaba los ojos del tigre, pero entre él, Reyes y Llull dieron la vuelta a un partido que pintaba fatal a 12 ó 13 minutos del final.

Además, Tomic jugó en los minutos importantes de un partido de esos que curten a los jugadores, así que le vendrá muy bien todo lo que aprendió ayer.

Grandísimo partido de nuevo de Llull que tiene como mejor virtud que contagia al resto del equipo: en los últimos 10 minutos Prigioni pasó de hacer un partido horrible a comerse a McIntyre.

Muy bien también la última jugada de Messina, sacando a Bullock para impedir que a Llull le hicieran un 2 contra 1 y ordenando una jugada sencilla: los aleros abiertos, lejos de Llull y balón a éste para que se juegue el 1 contra 1 buscando o la falta o el tiro.

En definitiva: valiente Messina en sus decisiones, consciente de que se jugaba el puesto y muy bien la actitud del equipo de nuevo, que, pese a estar maniatado durante 30 minutos, ni se descompuso ni se vino abajo. Gran trabajo defensivo del equipo. Ahora falta que el ataque se vuelva a ajustar como en diciembre.

Saludos

259 Nottias, día

Buenos días a todos. Que cerquita estuvo ayer el Madrid de la eliminación en la Euroliga. Tuvo que venir Llull con el apagafuegos, y Tomic como solución de urgencia de Messina para mantener una leve esperanza de hacer algo más en esta competición. Yo no veo que Messina sea el gran problema, sino lo pusilánimes que están más de uno a la hora de jugar. !!Un poco más de impetu y de sangre, que a veces parecen cuajados, como el Granada cuando juega fuera de casa!!

Enhorabuena a los atléticos y valencianistas, a ver si dejamos el pabellón español más alto en esta competición de la Europa League.

260 Jauminha, día

Hace ya bastantes años, con el carné de conducir recién aprobado, se me calaba mi Opel Corsa City... antes de eso, sin carné de coche, se me gripaba mi Derbi Variant Start... pero nunca pensé que a un Ferrari pilotado por un bicampeón mundial le pudiese pasar lo mismo.

261 cule1899, día

Para los amantes de las emociones fuertes ... sería divertido lo siguiente ...
Que haya unos cuartos de Champions Barça-Madrid y que haya unos cruces de cuartos en la Euroleague Barça-Madrid, que combinado con fechas Liga ... quedaría

23 de Marzo - Barça/Madrid - Partido 1 Cuartos Euroleague
26 de Marzo - Barça/Madrid - Partido 2 Cuartos Euroleague
29 de Marzo - Madrid/Barça - Partido 3 Cuartos Eurolegue
31 de Marzo - ¿Barça/Madrid? - Ida Cuartos Champions
2 de Abril - Madrid/Barça - ¿Partido 4 Cuartos Euroleague?
7 de Abril - Barça/Madrid - ¿Partido 5 Cuartos Euroleague?
7 de Abril - ¿Madrid/Barça? - Vuelta Cuartos Champions
10 de Abril - Madrid/Barça - Jornada Liga Fútbol
11 de Abril - Barça/Madrid - Jornada Liga Basket

Joer ... esto es una procesión de Semana Santa (semana del 29 de Marzo hasta el 5 de Abril) ... y los demás son tonterías :).

262 wsmith, día

Jajajaja

Jauminha,

pregúntale a Hamilton cómo perdió el mundial en su primer año en la F1.

Por cierto, el otro día Nelsinho se estrelló contra el muro en la Nascar. ¿Órdenes de equipo para que ganara Alonso? ¿Alonso está en la Nascar?

Saludos

263 wsmith, día

J0der culé,

menudo empacho. Menos mal que como lo estás prediciendo tú no va a pasar. :-)

264 ispiriux, día

Hola buenos días:

Joer cule1899, con ese calendario que planteas, tendré que acumular grandes cantidades de tila, valerianas, dodotis y fortasec.
XDDDDDDDDDDDDDDDDDDDDDDDDDDDD

Jauminha, que bueno verte de nuevo.
¿Que tal por Ses Illes?


que tengais un buen día

265 cocoom, día

Buenos días.

ispiriux

De todo eso que dices no sé, pero de cerveza y cosas para picar, tenlo por seguro. Vaya pastizal. Luego no habrá Dios que se ponga el bañador...

wsmith

En realidad Murinho, digo Nelsinho, escogió la competición adeacuada para el piloto adecuado.

De todos es conocido la querencia del gran piloto brasileiro por arrimarse a las paredes y tambien es sobradamente conocida la Nascar por los choques espectaculares contra el muro.

Si analizas un poco, el año pasado casi no hubo colisiones importantes contra los muros en los óvalos norteamericanos y eso es parte del espectáculo.

Conclusión: Para devolver el espectáculo contratan a un especialista, mejor dicho, contratan a "el especialista".

Hoy ALO va "por faena": 1:21:352 y bajando

266 ispiriux, día

cocoom:
yo ya le estoy dando duro al spining (3 veces a la semana) para poder llegar a junio en condiciones atléticas más o menos aceptables.
XDDD

267 Jauminha, día

Hola Ispiriux.

Por "ses illes" todo bien, gracias.

Parece que este fin de semana nos libraremos de la "tormenta perfecta" que anuncia en la península y tendremos solete. Además aquí el lunes es festivo.

culé, espero que no se cumplan tus predicciones. Serían por un lado demasiados "partidos del siglo" en pocas semanas, y por otro, después la vida se volvería aburridísima hasta el 2011.

268 ostane, día

Buenos días,
lo primero de todo, gracias pablo1.

Para los que hablan de Raúl entrenador... primero tendrá que sacarse el título. Me supongo que el comentario sería irónico.
Baloncesto: grandísimo Llull ayer. El último cuarto es para enmarcar, y el segundo y casi todo el tercero, para olvidar.
La victoria por 8 nos permite pensar, si superamos el average con el Maccabi, que seremos primeros de grupo, y si el Barça cumple con el guión, también será primero, con lo cual evitaremos el cruce con los azulgrana, lo que sería muy difícil de superar, pues sería necesario vencer en el Palau.

Voy a ver si hoy, por fin, puedo ver la entrevista a Gonzalo...

Por cierto, tengo un amigo zulú bastante enfadado por la importancia que se le está dando a otras etnias en este blog.

269 wsmith, día

cocoom

Eso sí, antes de tragarse el muro se llevó por delante a Danica Patrick.

http://blogs.20minutos.es/formula-1-alonso/post/20...

Por cierto, hoy el F10 sí lleva la aleta de tiburón unida al alerón trasero:

http://www.marca.com/deporte/motor/formula1/2010/d...

270 Juan Manuel Rodríguez, día

Para Tudemial: Muchísimas gracias por el soneto. Como no podía ser de otra forma me ha encantado. Es una rara habilidad esa que tienes; yo lo he intentado alguna vez y no me sale. Felicidades por tu ingenio. Y mil gracias por la bonita dedicatoria.

271 ostane, día

Felicidades a los atléticos y al valencianista (creo que solo hay uno) del blog.
Sorprendente lo del Bilbao, y Gorka tragándose un gol, el que lo paró todo el día del Madrid.

272 Jauminha, día

Tudemial, fantástico tu soneto.

Qué gran arte esa que esconde tu cabeza.

273 ostane, día

El Líder me acaba de recordar un olvido imperdonable: Tudemial, ya estás tardando en darnos a conocer otra composición de las tuyas.

274 cocoom, día

Don Juanma, bien hallado.

wsmith

Para poner esas fotos mejor que no pongan nada, se ve la aleta pero no se ve como acaba, que es lo importante. Que te voy a decir yo que tú no sepas ;-).

ostane

No tiene desperdicio la entrevista. A algunos periodistas deportivos se les ha visto el plumero y los ha "volteado" un crío de 21 años...

275 ostane, día

No es massai, es Massaro

276 wsmith, día

cocoom

Sí se ve, baja al final de la página, la primer aimagen que hay la muestra bastante bien.

277 wsmith, día

cocoom

http://www.as.com/prom/201002/pro_photo1267169303....

278 cocoom, día

wsmith

Correcto, me pudieron las ansias y la animadversión al Marca.

279 chu4che, día

vaya triple de Llull,que grande,con rectificado en el aire,increible

280 ispiriux, día

Jejejejejejejeje.

Gracias a ese fantástico triple de Sergio Llull, en lugar de eliminaros el FCB -lo cual siempre es más doloroso- os eliminará el Partizan, cosa más llevadera.


un saludo.

281 cocoom, día

wsmith

¿Sabes de alguna web para poder seguir las carreras sin publi?.

No creo que aguante al Lobato y a La Secta otra temporada más...

282 wsmith, día

cocoom

Ni idea, pero me suena que en Roja Directa el año pasado había enlaces también a la F1.

El F10 está volando.

283 wsmith, día

Jajajaja

Menudo año nos espera...

Lobato
+
Alonso en Ferrari
+
El Ferrari que parece el mejor coche
+
De la Rosa en la pista
+
Sin De la Rosa para poner cordura en las retransmisiones

Menos mal que Lobato se peleó con Gonzalo Serrano.

284 cocoom, día

wsmith

De todasformas, sin ser serranista, este le da mil millones de vueltas a Lobato. Al menos sabe de lo que habla.

Creo que, para ayudar a dormirnos, junto a Seara, están pensando en poner como comentarista técnico a Del Bosque :PPPP

285 wsmith, día

Sí, y al Buitre para hacer las entrevistas en boxes.

286 ispiriux, día

La verdad es que el lobato es insoportable.

además habla chillando.


Lobato, chúpamela un rato.

XD

PS.: en TV3 tenemos a un tal Aguilera que es ingeniero de automoción, de voz suave y gran conocimiento de F1 que nos da detalles tecnicos interesantes.
Por contra tenemos a un tal Rosés, que es la versión autóctona del Lobato.
Que se le va a hacer.

287 wsmith, día

Veo que ayer Jasickevicius sólo jugó 10 minutos. En la ida contra el Barça no pisó el campo y tampoco lo hizo en los partidos contra el Madrid. ¿Tiene un problema con Obradovic?, porque en la vuelta contra el Madrid, al menos, no estaba lesionado y Obradovic le tuvo todo el partido calentando con una cara de cabreo considerable.

Qué manera de desaprovechar un jugador.

Obradovic me imagino que irá a la calle, porque quedarte fuera en la Euroliga, perdiendo 2 veces con el Madrid, 2 con el Barça, y al menos 1 contra Partizan y Maroussi, siendo el campeón de Europa y teniendo una gran plantilla es un fracaso grande.

Enhorabuena culés.

Y acordaos de quedar en el mismo puesto que nosotros... ;-)

Se me olvida: Torino enhorabuena

288 cocoom, día

ispiriux

Los que podáis disfrutar de una carrera de F1 en TV3, al menos el año pasado, tenéis una suerte descomunal. No hay pausas publicitarias, emiten en un HD bastante decente y con sonido Dolby Digital 5.1.

Vamos, que enchufar el deco y oir el rugido de un F1 con unos buenos altavoces es una sinfonía.

Ah y la chica de las entrevista, muuuy mona ;-)

Ah un pero. Uno, que sólo habla catalán en la intimidad, se pierde muchas cosas del comentarista técnico. Alguna carrera he seguido por TV3 en casa de un amigo que la sintoniza. Por suerte el me las ha traducido. Es una rara avis, que, por casualidades de la vida, siendo catalán ha caído en la cuidad donde vivo y se cas´´o con una hermana de un amigo. Es culé hasta las trancas, con mucho seny y gran comedor de botillo y no se queda atrás con el de cava, que siempre tiene de muy buena calidad.

A mí lo que me ofusca de La Secta es la pu.ta publicidad. Los comentarios no los oigo, porque estoy pendiente del Live Timing, que así me entero de como va la carrera.

289 wsmith, día

Lo peor de LaSecta con la publicidad, aparte de que te ponen la pantallita minúscula, es que te plantan en vídeo con la carátula del programa que es interminable y te pierdes una vuelta cada vez.

Y luego te salía el otro con y si parpadean se lo van a perder..., sí, salvo cuando ponen anuncios, que hay que aprovechar para humedecer bien los ojos, porque una hora y media sin poder pestañear... como para que se te cristalicen las corneas, oyes.

Me acuerdo del mundial que ganó Jacques Villenueve, que lo veía por Eurosport en inglés. Los comentarios técnicos iban a cargo de un expiloto inglés (no recuerdo quién) y no había payasadas lobatiles ni nada de eso. Qué tiempos...

290 Aliocha, día

Por suerte no tengo vuestro problema con la retransmisión de la F1 porque las carreras me aburren soberanamente.

291 cocoom, día

Aliocha

Pues no sabes lo que ganas en salud. Lobato es insoportable.

292 wsmith, día

Naaaa... A Lobato lo que le pasa es que está enamorado de Alonso y es un sentimiento tan bonito que quiere compartirlo con todos nosotros...

Yo pondría a Jauminha a retransmitir las carreras con Lobato, para que haga de contrapunto.

293 cocoom, día

wsmith

El problema es que nuestro ilustre mallorquín podría venirse abajo, igual que le sucedió a algún que otro periodista cuando tuvo cara a cara a Higuaín en Punto Pelota.

El Sauber y el Toro Rosso parecen rápidos para calificación. Luego en tandas largas son menos consistentes, pero no serán comparsas, como Lotus y Virgin. Estos últimos serán conos en los circuitos, que habrá que sortear hábilmente a partir de la vuelta 10 o así...

294 wsmith, día

cocoom

El Force India también parece rápido a una vuelta.

Este año puede haber muchos conos, porque todavía faltan los Campos Meta y los Stefan Gp, si es que al final llegan a tiempo.

McLaren no me termina de convencer y Mercedes tampoco parece muy fino.

295 Azulon, día

Buenos días,

Vengo de tomar un cafelito y de ojear (no confundir con hojear) el Marca. Y hete aquí que me sorprenden con un "sesudo" estudio sobre el posicionamiento de Kaká. Pues resulta que juega en la misma posición que lo hacía en el Milán y que hace con Brasil.

Y nosotros pensando que la culpa era de Pellegrini (como no)

296 wsmith, día

Pues Pellegrini dimisión por poner a Kaká en el mismo sitio que jugaba en Milán y con Brasil!!!

297 cocoom, día

wsmith

Sobre Mercedes GP.

Azulon

Cualquier cosa menos sesudo, viniendo de donde viene...

Ah y pásate por el Buzz

298 wsmith, día

cocoom

Habrá que esperar pues a ver qué se saca Brawn.

299 Azulon, día

Wsmit

Eso, eso dimisión. Y como tu dices, además "por llevar calcetines blancos"

300 Rojo4, día

Sobre la actitud del Real Madrid ayer, de muy bien nada, digo yo. Si no se pasó por encima del Montepaschi fue por un problema de actitud, estaban acobardados, Kaukenas recibió un tapón porque no se atrevió a tirar de cuatro metros al primer intento. Sí que fue bueno que fueran capaces, gracias al empujón de Llull, de recuperar el ánimo y apretar el último cuarto.

No creo yo que estuvieran las cosas tan tan mal; cierto que perdiendo contra el Montepaschi las cosas se hubieran puesto complicadas, pero aún se podía pasar ganando los siguientes dos partidos; tal como están, creo que siguen necesitando ganar los dos, aunque según resultados podrían permitirse perder uno.

301 dienekes, día

Azulon, si no has "hojeado" el Marca será que solo has visto la portada, je, je.

¿Que Pellegrini lleva calcetines blancos? ¿Y el Marca no lo ha sacado todavía en portada? :P

302 Azulon, día

Cocoom

Yo pasar por Buzz STOP No encontrar nadie STOP Bombilla linterna debe estar fundida STOP Yo volver aquí STOP Pero marchar rapido trabajo pendiente STOP

303 dienekes, día

Rojo4,

No sé si lo comentaste ayer, pero auqnue sigue pareciéndome flojito vi algunos movimientos suyos en ataque que me dejaron sorprendidos.

Por otra parte, ¿qué crees que pensará Bullock después de que Messina diera el balón definitivo a Llull?

304 cule1899, día

wsmith, ispiriux, jauminha: no creo que pase todo ... simplemente digo que es una posibilidad.
Los Cuartos Champions en fútbol ... no los veo.
En cambio, los cruces en cuartos de Euroliga ... ya los veo más. Veo que con el multiempate el Madrid ahora va segundo ...
Por cierto, no me extrañaría nada que al final, en el grupo del Madrid, todos los equipos ganaran sus 3 partidos de casa y perdieran sus 3 partidos de fuera.
Y veo que entonces ya no va por basket average, sino por diferencia en puntos a favor y en contra.
Juer ... quedar primero o último puede ir de un par de canastas.

305 Hegemon1, día

¡¡Tiempazo de Alonso!!...buenas sensaciones con el Ferrari F10. Bajar del 1:20:9 es muy buena noticia. Alonso, en pretemporada, no enseña cartas ni le importan los tiempos pero que esté haciendo los mejores ya dice mucho. Espero no equivocarme.

306 Azulon, día

Dienekes. Ojear. Cuarta acepción del RAE.

307 dienekes, día

Rojo4, me refería a Tomic, claro

(qué empanada tengo)

308 Aliocha, día

¿No os gusta Lobato? Pues toma tres tazas

309 dienekes, día

Sí, si tienes razón, Azulón, pero si has "mirado superficialmente" el periódico, también habrás tenido que "hojearlo", no?:

1. tr. Mover o pasar ligeramente las hojas de un libro o de un cuaderno.

2. tr. Pasar las hojas de un libro, leyendo deprisa algunos pasajes.

Yo creo que es lo mismo en este caso, pero puede que tengas razón. En cualquier caso, era una broma.

310 wsmith, día

dienekes

Bullock hizo un partido desastroso, como para confiarle el último tiro. Messina le sacó claramente para liberar a Llull de un defensor.

Rojo4

Espesos en ataque, sobre todo por el pésimo porcentaje de tiro, pero aplicados en defensa y sin bajar los brazos a pesar de todo. La actitud fue buena. Lo que faltó fue confianza en sus posibilidades despué sdel varapalo de la final de copa. Hace 2 semanas, en Siena bajaron los brazos en el minuto 12, con el partido trasncurriendo por los mismos cauces. Ayer no lo hicieron.

311 wsmith, día

De la Rosa también baja de 1:21. El motor Ferrari parce superior al del resto.

312 Azulon, día

Dienekes.

Yo tomar cafelito en barra cafeteria. Vecino desconocido a mi izquierda. El tener abierto Marca sobre barra. Yo ojear pagina abierta. A él no importar yo mirar. Yo terminar cafelito. Pagar y dejar propina. Salir de allí. Subir oficina. Secretaria saludar. Yo mirar trasero.

313 dienekes, día

Eres un cachondo, Azulon

Pero touché.

Por cierto, para nuestro querido Bryson (aunque ahora lo esté pasando mal), que comparte conmigo afinidades literarias, le voy a enlazar una entrevista de Pérez Reverte en El Cultural:

http://www.elcultural.es/version_papel/letras/2669...

Y os dejo una perlita:

"Que un político analfabeto, sea del partido que sea, que no ha leído un libro en su vida, me hable de memoria histórica porque le contó su abuelo algo, no me vale para nada".

314 frjparen, día

Tú "ojear" trasero.

315 cg, día

Tudemial, tu soneto es magnífico y muy difícil de lograr (ya espero con ansia que se produzca la siguiente disputa enconada, si de ello ha de surgir otro genial soneto), y a Dédalus no le falló la intuición en cuanto al patrón métrico, se le nota su buen ojo para la poesía. Me he tomado la licencia de analizarlo detenidamente (espero no haberme equivocado).

Tus endecasílabos son del tipo a maiore, (tienen el acento rítmico central en la sexta sílaba) del subtipo enfático: acentos en la segunda y décima sílabas, más el ya dicho central en la sexta:

(sigue, por supuesto)

316 flintoff, día

Si tu mirar trasero ¿importar a secretaria?

(Si a secretaria no importar, yo querer esa secretaria)

317 cg, día

I--ni-coa-la-vez // que-di-ver-ti-do

Cam-bian-do-(de o)-pi-nión // según-con-vie-ne

Pe-núl-ti-mo-guar-dián // (de a)-quel-que-tie-ne

Más-blan-(co el)-co-ra-zón // (que el)-a-pe-lli-do


Vo-ce-ro-(de un)-es-ta-dio // que-mur-mu-ra

Prag--ti-co-(hiato)y-fiel // al-ca-te-cis-mo

In--li-(to e)-jem-plar // de-ma-dri-dis-mo

En-más-(de u)-(na o)-ca-sión // ge-(nio y)-fi-gu-ra


Re-pli-ca-per-ti-naz // al-ma-ja-de-ro

Que-di-ce-(que hi)-gua-ín // es-co-sa-fi-na

El-chico-no-(le o)-fre-ce // na-da-nue-vo


Y-(si in)-cau-to-pro-me-(te el) // in-ge-nie-ro

Que-lle-va-(la a)-le-grï(diéresis)-(a a) // con-(ha es)-pi-na*

A-llí-(lo es)-pe-ra- // co-mien-(do un)-hue-vo


*Este verso es el que propuso Dédalus para cuadrar el endecasílabo, y está muy bien porque sigue manteniendo el mismo patrón (no obligatorio) de endecasílabo enfático que encontramos en todos los demás versos (acentos en la segunda, sexta y décima sílabas). Pero tengo mis dudas de que sea posible la diéresis en “alegría” (la vocal “i” es la fuerte). No lo sé.
Otra opción, no sin algunas reservas por el acento en la cuarta sílaba, podría ser:

Que-lle-va--la--(cha a) // con-(cha es)-pi-na

Info

318 Azulon, día

Frijapen.

No ojear trasero. Escrutar trasero.

Dienekes

http://www.elmanifiesto.com/articulos.asp?idarticu...

319 cg, día

Vaya, me he equivocado, tus endecasílabos no son enfáticos, son, como no podía ser de otra manera, heroicos. Ver enlace de arriba.

320 wsmith, día

Azulon saber que estar mal no compartir.

321 flintoff, día

Los 23 para Francia, y se supone, el Mundial.

Real Madrid: Casillas, Sergio Ramos, Albiol, Arbeloa, Xabi Alonso.
Barcelona: Piqué, Puyol, Busquets, Xavi e Iniesta.
Valencia: Marchena, Silva, Mata y Villa.
Villarreal: Diego López, Capdevila y Senna.
Sevilla: Navas y Negredo.
Liverpool: Reina y Torres.
Arsenal: Cesc Fábregas.
Fenerbahce: Güiza.

322 ojalanci, día

culé,

Si se da esa avalancha de partidos entre Barça y Madrid, te propongo un trato: vosotros ganáis todos los de basket, y nosotros todos los de fútbol. ¿Hace? :-p

323 melkkiad, día

Buenos días a todos,

Lo primero agradecer a Tudemial (135)y cocoom (181) por acordarse de la situación del Athletic.

Mi comentario del partido la pongo a continuación: una mierda!!!

Supongo que la justicia divina nos ha hecho caer eliminados después de lo del otro día en San Mamés. Solo espero, que ya que los belgas también tuvieron su parte en los incidentes, la misma justicia divina los elimine en la siguiente eliminatoria. (je, eso es ser vengativo).

Bueno, este finde me voy a Soria. ¿alguna recomendación?

Saludos a todos

324 ispiriux, día

me sobran güiza y diego lópez y me faltan pedrito y valdés.

no lo digo por ser culé, ya que por si de mí dependiera no iría ninguno del FCB por cansancio y lesiones y eso, sino por que creo que objetivamente los que incluiría son mejores que los que excluiría.

saludos

325 ispiriux, día

melkkiad:

4 recomendaciones:

1.- abrígate
2.- migas de pastor con torreznos en un restaurante de la plaza mayor, cuyo nombre no recuerdo.
3.- paseo de la curva del duero (curva de ballesta)
4.-ruinas de numancia. sobrecogedoras.

que te vaya bonito.

326 Metalmad, día

Mellkkiad:

Abrígate

327 Azulon, día

Wsmith

Yo compartir. Pero novio secretaria ser reacio.

Melkkiad (323)

Recomendación

http://www.youtube.com/watch?v=FE_x9-krvl4

328 ispiriux, día

Soria es para mí una de las ciudades más bonitas de españa.
Su espíritu castellano es único, más vivo en mi opinión que en valladolid o burgos por ejemplo.
Y además tiene una gran importancia en la obra de Antonio Machado.

Ya nos contarás.

329 ostane, día

¿No hay nadie mejor que machacapiernas-semevalaolla Marchena?

330 Metalmad, día

Me sobra Reina y me falta Valdés.

España no puede llevar a un tipo como Marchena a la selección. Se le va la pinza en un partido y te deja con 10 por menos de na.

Navas..., puffff, miedito me da. Ahora que no se si llevaría a Pedrito al mundial. Depende de como acabara la temporada.

Güiza sigue jugando al fútbol en Turquía?? No hay otro delantero en mejor forma que él??

331 dienekes, día

Melkkiad,

Si el viento te lo permite, no te pierdas el paseo por la ribera del Duero hasta la ermita de San Saturio, excavada en la roca. Impresionante. Además, es el lugar del famoso "olmo seco, hendido por el rayo..."

332 frjparen, día


Para que os emocionéis de nuevo con el triple de Llull, esta vez desde el punto de vista de un espectador del pabellón.

Disfrutad!

333 Aliocha, día

A mí me sobra Negredo y me falta Cazorla (creo que está lesionado), esa sería mi lista para el Mundial.

Pedro no ha ido ni una sola vez convocado con la selección absoluta y además no es titular habitualmente en el Barça.

Cada español lleva un seleccionador dentro.

334 dienekes, día

Pues para mí, ni Pedrito ni Cazorla: yo llevaría Pablito "Furby" Hernández.

Y a Güiza, ni de coña.

335 ispiriux, día

puestos a pedir sustitutos del Güiza, que os parecería Llorente del At Bilbao?

336 cule1899, día

ojalanci: no hace :).

337 melkkiad, día

Muchas gracias compañeros por las recomendaciones sobre Soria. Intentaré visitar todos los sitios que pueda, o que el tiempo me permita.

Un deseo para este finde: que ganen todos nuestros equipos ¿será posible?

338 Azulon, día

Observo con asombro que no están convocados ni C. Ronaldo, ni Messi ni el Kung. ¿Pero qué leches de Seleccionador tenemos? ¿Cómo vamos a ganar el Mundial?

Esto es cosa de Pellegrini. Seguro.

Ah! que no son de aqui? Es igual. Inga, dale a Pellegrini.

339 Rojo4, día

Hombre, eso es cierto, en defensa trabajaron bien todo el partido, no se rindieron ahí, con lo que tan mala no fue; aún así, lo de ese ataque de Kaukenas...

Bullock es lo suficientemente mayor para darse cuenta que tras el partido tan desastroso que hizo lo lógico era trabajar como distracción, no como el que fuera a decidir. Llull fue quien cargó con el equipo a su espalda y lo llevó a la victoria, con la colaboración necesaria de Tomic y Reyes.

340 Eddie79, día

Buenas.

En cuanto a la selección, a mi sobra Diego López, y me falta Palop, creo que lo está mereciendo y forma parte del grupo Campeón de Europa.

Guiza, me parece un delantero con mucha movilidad y perfecto recambio para Torres, puesto que éste convendremos que tiene bonus para esta convocatoria, Llorente es más del tipo Negredo, y prefiero al vallecano, aunque lleve peores números.

Marchena no ha perdido un sólo partido con la Selección, y lleva unos cuantos. Simplemente por eso, hay que llevárselo. Quien sabe si los jugadores son supersticiosos.

Un saludo.

341 Jauminha, día

#292 wsmith y #293 cocoom, ¿tanta desgracia me deseáis que queréis que me pase todo un fin de semana viendo como pasan los coches al lado de un calvo?

Creo que desde que alguien del blog me dijo "púdrete" nadie me había deseado tanto mal. ¿Qué he hecho yo para merecer esto?

Por otro lado, parece que el puto Ferrari vuela.

-

Güiza. Me parece un buen delantero de banquillo. Ha demostrado que sabe estar sentado y que cuando sale lo da todo e incluso tiene muchas ocasiones de gol por los minutos que juega.

Marchena. Creo que en todo equipo tiene que haber un marrullero para poner las cosas en su sitio cuando toca. Y más teniendo tantos jugones tipo Xavi, Iniesta y Cesc. Alguien ha de defenderlos.

Diego López. No sé quién es.

342 wsmith, día

Azulon

Novio secretaria necesitar correctivo.

343 dienekes, día

Desde luego, Bullock no tuvo un buen día, pero me refería a qué se le debe pasar por la cabeza a un tipo acostumbrado a ese tiro y ahora se ve relegado de ese rol.

344 Jauminha, día

eddie79, Palop irá al Mundial. Allí se llevan 3 porteros por si las moscas. Que si te sancionan o lesionan a uno, ya no tienes portero suplente en el siguiente partido.

345 Azulon, día

Fascinante video de Guiza, elaborado por aficionados del Fenerbache.

http://www.metacafe.com/watch/3744992/daniel_g_iza...

Será pichichi en el Mundial.

346 wsmith, día

dienekes

Bullock, con los años que lleva jugando al baloncesto, debe ser lo suficientemente profesional como para saber que ayer la última jugada no le correspondía él, porque no había metido ni una y Llull estaba en racha. Si Bullock ayer hubiera tenido un buen día, seguramente habría sido una opción en la jugada.

Supongo que lo entendió así y no creo que hubiera ningún problema.

347 wsmith, día

Jauminha

No hombre, no es nada personal. :-D

Si conoces un mejor candidato para acompañar a Lobato, no tienes más que proponerlo. :-D

348 elmarque, día

cocoom: por qué capítulo vas de Spartcus? yo he visto los cinco primeros, pero el sexto no lo encuentro por ningún lado.

349 cosrroes, día


Hola.

Reglas para la buena convivencia y la excelencia del blog.

Ojo, que no son meras recomendaciones. Deben ser obsevadas pusilanimemente si no queremos que esto se convierta en la cueva de la Curra.

1. No poner enlaces de tias macizas. Los cavernicolas tendremos que disimular que somos unos animales y controlar nuestros instintos básicos (intentémoslo al menos en el blog) para no interrumpir los elevados pensamientos expresados aquí por otros compañeros.

2. Prohibido hacer series presuntamente cómicas (y menos de Messi), hacerse pasar por masais, saltarines o no, entrenadores italianos de pallacanestro, o por otros compañeros de blog, con la perversa intención (fallida) de caricaturizar sus profundos y acertados análisis sobre la cosa furgolística.

3. No reirle las payasadas a Capaldi y a Bryson, que eso les anima, y no hay peor cosa que celebrarle las tonterías a un tonto para que no las deje. Eso, además, mantiene el bajísimo nivel del blog, más aún cuando no se valoran justamente los únicos post que elevan la ínfima categoria del blog. Post de compañeros mucho más preparados; con cultura, cifras, letras y una esgrima dialéctica incomprensible para cromañones balbucientes y primarios como nosotros.





350 Azulon, día


http://www.todoavatar.com/wp-content/uploads/2008/...

Opss! Perdón, Cosrroes

351 Rojo4, día

O sea, que sí tenemos himno del blog

352 erzuru, día

Buenos dias...y adiós que me piro de viaje.

Solo un par de cosillas: de los de la lista de D. Vicente, me sobre el actual Iker Casillas, pero dado que la Carbonero va a ir al mundial, habrá que llevarlo. Me falta Adrian González, fino extremo izquierda y que no es un paquete. Me sobra Negredo y me falta Fernando Llorente. Me sobra el tronchacaimanes Busquets y me falta Granero. Guiza no y Palop sí. Y Pedro León, ¿por qué no?.

Por si las cosas no se dan para el culerío paletillo, un par de consejos: creo que en el Málaga juega un tal Fernando, ex del Madrid. Sobre él, a falta de Canales, pueden descargar toda sus frustraciones y complejos. Y dado que va a hacer un viento del carajo, un aviso: cuidado con los pañuelos moqueros, prendas diversas y artefactos variados que se utilicen para mostrar la mas que justificada indignación... que a la que te descuidas viene una racha de aire y a tomar por cu.lo el apaño. Aconsejo no llevar el pañuelo de los domingos...puede valer el de los días de diarios o un trapo de cocina. Pero, claro, ¡qué le va a decir un aficionado y humilde madridista a la afición master-experta en objetos arrojadizos, pancartas y artefactos simbológicos!. Poco, la verdad.

Envidio al resto de cavernarios. Vosotros calentitos y en vuestras cuevas. Y yo haciendo más kilómetros que el baúl de la Piquer. ¡Hala pues!, hasta otra amigos.

353 cosrroes, día



Esta noche hee invitado a cenar a mi cueva a unos amigos del clan vecino. He sacado un costillar de mamut del glaciar. Tenía más provisiones; bisontes, rinocerontes lanudos y otras delicatesen boreales, pero por culpa del puñetero cambio climático se ha descongelado un 40% del glaciar y se me han echado a perder. Por contra, el calentamiento global, que aprieta pero no ahoga, supuso un verano muy caluroso, por lo que la cosecha de vino ha resultado abundante y de calidad. Váyase lo uno por lo otro.

Comeremos, beberemos, reiremos y acabaremos cantando el Altamira, patria querida. Placeres sencillos y primarios.

354 Aliocha, día

La esgrima dialéctica está sobrevalorada.

355 Gorbi, día

Azulon,
¡me ficho a la primera!

Y que le den mucho a los esgrimistas. Esto es un blog de deportes, no de carnavales.

356 Gorbi, día

Y en homenaje a Ostane, que fue el que la presentó al blog:

http://www.nicewallpapers.info/pics/Celebrities/pa...

http://pivones.esfutbol.es/uploads/esfutbol.es/oth...

357 Eddie79, día

jauminha

ya estamos hablando del tercer portero, Diego López.

Primero y Segundo, Casillas y Reina, respectivamente, e intocables, cada uno por diversos motivos, según parece.

Por lo que si va Diego López, que me parece un porterazo(la parada de balonmano que le hizo a CR9 el otro día para enmarcar), no iría Palop.

Y posiblemente esté de acuerdo con erzuru en que Busquets también me sobra, y metería a Granero o a Pedro León.

Además estaría atento a los registros de Soldado, por si las moscas.

358 Rojo4, día

¡Jajaja! ¡Qué bueno! Os lo pongo en original (cursiva) y traducido:


***********************


While having lunch five surgeons from big cities are discussing who makes the best patients to operate on.

The first surgeon, from New York , says, "I like to see accountants on my operating table because when you open them up, everything inside is numbered.."

The second surgeon, from Chicago responds, "Yeah, but you should try electricians! Everything inside them is color coded.."

The third surgeon, from Dallas , says, "No, I really think librarians are the best, everything inside them is in alphabetical order"

The fourth surgeon, from Los Angeles chimes in: "You know, I like construction workers... Those guys always understand when you have a few parts left over."

But the fifth surgeon, from Washington DC , shut them all up when he observed: "You're all wrong. Politicians are the easiest to operate on.

There's no guts, no heart, no balls, no brains, and no spine.

Plus, the head and the butt are interchangeable."





****************************************


En una comida cinco cirujanos discuten qué clase de paciente es el mejor en una operación.

El primero dice "prefiero los contables, todo está numerado".

El segundo dice "sí, pero prueba electricistas, todo codificado por colores"

El tercero dice "no, los bibliotecarios, todo lo tienen en orden alfabético".

El cuarto dice que "los obreros de la construcción, ellos entienden cuando falta alguna parte".

El quinto les tapa la boca cuando responde "Estáis todos equivocados, los mejores son los políticos.

No tienen corazón ni estómago (guts = agallas = tripas) ni pelotas ni cerebro.

Además, la cabeza y el cul0 son intercambiables.

359 Jauminha, día

Si ya lo decía yo en el #341:

Diego López. No sé quién es.

Y si hablamos ya de Soldado, Granero etc.. yo metería en la lista de "posibles futiribles" a Aduritz.

360 Jauminha, día

Muy bueno rojo4.

361 Jauminha, día

Ni quitarse la camiseta, ni hacer el arquero, ni la cucaracha, ni nada de eso.

Para celebrar una victoria lo mejor es esto.

362 flintoff, día

¿Te refieres a celebrarlo bebiendo y fumando o a celebrarlo con unas rubias jovenes?
¿O todo junto? :)

363 Jauminha, día

Las fotos no tienen desperdicio, tiradas por el suelo, apoyadas la pared... pero lo mejor de la noticia es lo del "cava español".

Se ve claro que beben Segura Viudas, del grupo Freixenet, con sede en Cataluña, España.

364 cule1899, día

cosrroes:
"Comeremos, beberemos, reiremos y acabaremos cantando el Altamira, patria querida"

"Altamira, patria querida". Jajajajajajajajaja. Qué bueno. Jajajajajajajaja.

365 Capaldi, día

Sir Percival, me siento en la obligación de revisar esos discos este mismo fin de semana. Y si ya se retractó, reciba mis disculpas y que Dios le bendiga en abundancia. Jesús no llores. ¿Olvidó a Matt a la hora de confeccionar el top o no le cabía?

PD.- Le paso esto para un "on the road", a ser posible con descapotable y en sábado soleado, aunque supongo que ya lo tendrá. http://www.goear.com/listen/cb29b2e/checking-in-,c...

366 cocoom, día

Jauminha #341

Es cierto. El castigo me parece excesivo.

Busquemos otra víctima de Lobato...

elmarque #348

Por el 5º, que lo colgaron el pasado fin de semana.

Se supone que este finde colgarán el 6º

cosrroes

¿Las normas son de obligado cumplimiento?.

¿Vizcaína o Toledana?.

A mí mientras no sea un Tirachinas :PPPP

A la caverna

367 Osiris, día

cocoom

Si te gustan las de romanos, ¿te gustó Roma? Vi la primera temporada y me encantó. El último capítulo era sublime.

368 Capaldi, día

DIVAGACIONES

En algo parecen estar de acuerdo todos los madridistas sensatos y un puñadito de culés con dos dedos de frente: el Real ha vuelto para poner orden, para devolver las cosas a su punto de equilibrio. Como bien apuntaba no hace muchas fechas el Masaiciño (al que quiero bien pese a que cada vez me chupa más tiempo -¡que morro el del negro zumbón!- ) el júrgol del barsa deviene en vaho condensado, mientras que el de los blancos es un chorro a propulsión, algo parecido a un manguerazo (sí, aquí he colado de matute un pequeño homenaje al Buitre, que ya tocaba). El juego de los azulgranas no cobra emotividad, sigue bailando con la suficiencia, con la pequeñez, con la más fea, y lo hace hasta el hartazgo, diga lo que diga Ramón Besa en sus crónicas de EP (hay una justicia divina y ciertamente pagarán con creces estos excesos). Por lo demás, uno ya dejó dicho en su día que a SanPep se le está poniendo carita de Sísifo, y creo recordar que el bueno de Ossip asentía, dándome el consiguiente alegrón pues a Ossip lo tengo en gran consideración. Concluida la presente temporada, Pep Guatrolas debería tomar las de Villadiego y confirmarse en la premier, aunque Rosell se le ponga de rodillas (y no me malinterpreten).

Ya.

369 Capaldi, día

"Roma" está bastante bien, peaso Lacónico de mis entretelas y mis pespuntes. Me falta por ver el final. Va otra serie con menos recursos:




MASAI

http://www.youtube.com/watch?v=HrLKldM6jPo


http://www.youtube.com/watch?v=FIwHgBgQkbY
(si masái congelar a 0´48 correrse vivo, te lo juro de Nacho Vidal)

http://www.youtube.com/watch?v=AidkPPF49xc
(a 0´08 saltar hermano N´guome, masái culé algo conflictivo (no entrar en detalles) que saltar así de bien por echar nandrolona en cuenco de sangre todas las mañanas, te lo juro de Guatrolas). Opiniones ser libres pero hechos ser sagrados.


370 Osiris, día

¿A los massais les gustan las de romanos?

371 Capaldi, día

MASÁI


Hombre blanco (y sabio) Osiris a veces cometer errores. Si fijarse bien en rama 368 de este mismo tronco, poder comprobar que Masai no referirse en ningún momento a serie "Roma", hacerlo hombre blanco cuya cuenta de LD yo utilizar. Pese a error de bulto, Osiris ser bweno, ser el más sabio por ser el más lacónico, y mi saltar en honor suyo (incluyendo "salto de la rana", te lo juro de El Cordobés)


[...]

372 morlako, día

Me gustaría saber qué opina Juanma ahora de Forlán. Ese que gana tanto y que tan poco hace...

¿Cuándo arranca el circo de la F1?

Creo que no puede haber cuartos de final entre equipos del mismo país en la Champions. O sea que Madrid-Barça, a lo sumo, en semis.

373 Capaldi, día

MASÁI

Antes querer decir rama 369 del presente tronco; en rama 368 sólo escribir hombre blanco.



(Saltos no muy elevados, ahora para cubrir expediente)


Te lo juro de mi madre que Guerrero Masái no querer molestar a puntilloso bloguero de tez blanca que fijarse en ortografía, sintaxis, pragmática etc , de ahí que haber confirmado por dos fuentes de referencia que término “masái“ llevar tilde cuando uno expresarse en idioma de hombre blanco , te lo juro de Lázaro Carreter. Como quiera que Hombre Blanco Dedalus estar muy ocupado educando a bestias pardas (te lo juro de negraco Sidney Poitier en “Rebelión en las aulas”) yo trasladar a RAE duda grande como continente negro: “¿Escribirse “masái” con acento, siguiendo reglas ortográficas del español, o “masai” sin acento por considerarse un término de otro idioma?” Ellos ser amables y remitirme información que ser de gran utilidad para masái. Copiar y pegar para uso y disfrute de blogueros:


“En las palabras de otras lenguas que, por su falta de adaptación a la nuestra, escribimos con letra cursiva o entre comillas, así como en los nombres propios originales de tales lenguas, no se utilizará ningún acento que no exista en el idioma a que pertenecen. Ejemplos: marketing, catering, Aribau, Windsor, Washington. Si se trata de voces ya incorporadas a nuestra lengua o adaptadas completamente a su pronunciación y escritura, habrán de llevar tilde cuando lo exija la acentuación del español. Ejemplos: búnker, fútbol, París, Támesis, Milán, tráiler. Así, aunque esta palabra no figura en el Diccionario académico, debería acentuarse (masái) por ser palabra aguda terminada en vocal (al igual que bonsái y samurái). Aquellos nombres de tribus que tengan nombre en español o cuyo nombre no presente problemas de adecuación grafofonológica a nuestra lengua, se escriben en redonda: los masáis, los kikuyus, los mayas, etc. Reciba un cordial saludo”.



---

¿Cuándo haber nuevo tronco, Hombre Blanco Osiris?

374 cocoom, día

Osiris

Roma es una serie que tengo guardadita en el HD Multimedia, pero que no me he puesto con ella.

Todo el mundo habla maravillas, pero no he encontrado el momento.

Ando liado con Galáctica y 24 y, encima ahora, Spartacus.

Masái

Que sepa que el Amo Blanco celebra sus saltos, los bwenos y los de pre-calentamiento.

Cuide a su hermano de la nandrolona y de la vaca, de la del Beato de Rosario. Esa es mala de toda maldad y, además, a un guerrero Masái no lo hace falta "pegar el estirón".

Salu2

375 Osiris, día

Sí, sobraba una ese. Son dos errores de bulto.

PD-Desde pequeñito, debido a mi afición a los denostados documentales de naturaleza y a algún tebeo sobre fauna africana, me fascinan términos como masai mara, Cráter de Ngorongoro, Serengeti o Impala.

376 Osiris, día

Decir verdad hombre negro masái: dios Osiris tener tez blanca blanquísima.

377 chu4che, día

el blog esta muerto,donde esta la gente??????

378 Capaldi, día

Masái, para cerciorarse aún más, consultar también a Fundación del Español Urgente (EFE) y comunicarme que al escribir en idioma de Hombre Blanco ser mejor emplear la forma "masái", con tilde incorporada. En resumidas cuentas, que toda palabra aguda acabada en vocal acentuarse, coño, para qué andar perdiendo el tiempo.

En este caso particular, palabra terminar en diptongo.


(Diptongo ser palabra masai que también robarnos hombre blanco)


(Bwana blanco cocoom, mi agradecer palabras suyas y sugerirle revisión de serie "Raíces", que aquí en poblado acaba de estrenarse por la televisión del Valle del Ngorongoro. Posiblemente para usted y para compatriotas suyos serie "Raíces" aportar ya poco,envejecer malamente, pero masái creer que despreder sabiduría bwena. Ser serie dura, sí. Puto blanco poner argolla a Kunta y llamarlo Tobi todo el rato.

[Nueva tanda de saltos, esta vez gustándome, te lo juro de Kobe Bryant] (Ah, contarme a la salida del sol Gran Hechicero de Tribu que Hombre Blanco LLull dar anoche otro gran salto de calidad, que saltar un poco más y parecerse al mismísimo Kobe; luego ver imágenes en amstrad de bambú, si eso ) (Agradecer, de paso, a Hombre Blanco frjparen que haya traído aquí punto de vista de espectador del Vistalegre Arena, exactamente en este mismo tronco-rama 332)

379 marianop, día

Hablando de series, he leído que vuestro héroe favorito tiene piedras en la vejiga (o algo así que no recuerdo) y se ha tenido que parar el rodaje de "24" (la fascistoide...). Apañaos estáis si Jack Bauer tiene que salvar el mundo, todo un agente de la cia que debe guardar cama por un quítame ahí esos cálculos; más os valdría confiar en Torrente.

380 Osiris, día

Para héroe, héroe, Hiro Makamura. Pero sobre todo, Claire Bennet.

381 Capaldi, día

[377] Joder, ¿y nosotros no existir?

Hombre blanco Ostane teclear más arriba: “Por cierto, tengo un amigo zulú bastante enfadado por la importancia que se le está dando a otras etnias en este blog”. Masái responder: que le den (al zulú, claro). Dicho en swahili: "Omdawa Gaboni Kapuote Soka Brondalé nikulela n´gué!¨


Hoy hacer calor en poblado. Calor que te torras. Mucho África. Guerrero, por desgracia, tener que abandonar blog de Hombre Blanco en este preciso instante. Haber prisa en dejarles porque cocodrilo del Lago Mupuote (muy cerca de cráter, Osiris) estar mordisqueándome calandracas...(...) ... y masái siempre dar prioridad a salud. Saludo bweno y que felicidad inundar vuestras chozas este fin de semana.
Y larga vida a Mamadou Diarra.



Burundanga.

382 Osiris, día

Joé: Hiro Nakamura.

http://usera.imagecave.com/cafecafe/HaydenPanettie...

Urkugülü, cosrroes

383 Osiris, día

Otra heroína: Nicki Sanders:

http://xabee.net/media/1/20070515-heroes2.jpg

384 Gorbi, día

Jauminha,
me ha encantado ver a esas párvulas celebrarlo así tras ganar al eterno rival.
Ayyyy, la inocencia de la juventud, delante de todas las cámaras...


Osiris, ahora veo que la lista de jamonas te parecía un festival de embutidos.

Pero con esto no creas que estoy con Morlako, porque yo veo esto venirse a por mí con cara de lujuria y me cago por las patas abajo:

http://4.bp.blogspot.com/_lgrG2xMG3Gs/SARiAyw6omI/...

http://img147.imageshack.us/img147/2549/swilliams2...

http://poponthepop.com/images/gallery/serena-willi...

Herramientas